Incidental Mutation 'R4890:Or5m12'
ID 377237
Institutional Source Beutler Lab
Gene Symbol Or5m12
Ensembl Gene ENSMUSG00000075206
Gene Name olfactory receptor family 5 subfamily M member 12
Synonyms Olfr1024, GA_x6K02T2Q125-47384320-47383337, MOR197-1
MMRRC Submission 042495-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.153) question?
Stock # R4890 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 85734413-85735396 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 85735092 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 102 (C102Y)
Ref Sequence ENSEMBL: ENSMUSP00000097496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099912]
AlphaFold A2ASU7
Predicted Effect possibly damaging
Transcript: ENSMUST00000099912
AA Change: C102Y

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097496
Gene: ENSMUSG00000075206
AA Change: C102Y

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 7.6e-52 PFAM
Pfam:7tm_1 46 295 4.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215677
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T C 1: 130,668,725 (GRCm39) probably benign Het
Adcy4 C T 14: 56,016,486 (GRCm39) D322N probably damaging Het
Adgrb3 T C 1: 25,260,908 (GRCm39) N916S probably damaging Het
Aox1 T C 1: 58,373,862 (GRCm39) V841A probably benign Het
Baz2b A T 2: 59,756,383 (GRCm39) M983K probably damaging Het
C2cd2l A G 9: 44,222,430 (GRCm39) F682L probably damaging Het
Ccsap T G 8: 124,572,160 (GRCm39) E114A possibly damaging Het
Cept1 T A 3: 106,413,123 (GRCm39) T201S probably damaging Het
Cfap221 T C 1: 119,883,476 (GRCm39) M232V probably benign Het
Chsy1 A G 7: 65,759,974 (GRCm39) R106G probably benign Het
Cit C T 5: 116,126,182 (GRCm39) probably benign Het
Cldn7 G A 11: 69,857,918 (GRCm39) V42I probably benign Het
Cnnm4 T A 1: 36,511,345 (GRCm39) V191E probably benign Het
Cntf A T 19: 12,741,326 (GRCm39) V178D possibly damaging Het
Ctsz C A 2: 174,270,393 (GRCm39) R263L probably damaging Het
Dclk1 T C 3: 55,429,353 (GRCm39) M407T probably benign Het
Dennd1a A T 2: 38,066,238 (GRCm39) probably benign Het
Dnhd1 A G 7: 105,306,164 (GRCm39) I368V possibly damaging Het
Gak A T 5: 108,728,742 (GRCm39) probably benign Het
Hepacam2 A T 6: 3,487,231 (GRCm39) V42D probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,366,470 (GRCm39) probably benign Het
Insr T A 8: 3,248,234 (GRCm39) Q437L probably benign Het
Itga8 G A 2: 12,198,102 (GRCm39) probably benign Het
Kansl1 A T 11: 104,233,868 (GRCm39) C732S probably benign Het
Kdsr T C 1: 106,680,964 (GRCm39) K78R probably benign Het
Kif14 T C 1: 136,414,868 (GRCm39) S785P possibly damaging Het
Lbr C A 1: 181,645,133 (GRCm39) L506F probably benign Het
Macf1 C A 4: 123,342,031 (GRCm39) C2720F probably damaging Het
Mapt G A 11: 104,218,975 (GRCm39) D738N probably damaging Het
Mroh9 T C 1: 162,854,093 (GRCm39) Y769C probably damaging Het
Mylk2 A G 2: 152,762,274 (GRCm39) N515S possibly damaging Het
Myorg G A 4: 41,498,877 (GRCm39) T251M probably benign Het
Nek10 T A 14: 14,860,986 (GRCm38) L513M possibly damaging Het
Nrxn2 A T 19: 6,498,308 (GRCm39) S258C possibly damaging Het
Nudt16l2 A T 9: 105,021,786 (GRCm39) S87T possibly damaging Het
Or52e15 G A 7: 104,645,311 (GRCm39) H267Y probably benign Het
Or6c1b C T 10: 129,272,948 (GRCm39) T89I probably benign Het
Or6z5 T A 7: 6,477,848 (GRCm39) C246* probably null Het
Or8c15 G T 9: 38,120,586 (GRCm39) C79F probably benign Het
Osgin2 G A 4: 16,013,739 (GRCm39) probably benign Het
Otud3 G A 4: 138,641,060 (GRCm39) R27W probably damaging Het
Pcare C T 17: 72,059,306 (GRCm39) V124I possibly damaging Het
Pcdhga12 T A 18: 37,901,290 (GRCm39) F707L possibly damaging Het
Pik3r1 T C 13: 101,894,118 (GRCm39) E17G probably damaging Het
Pramel19 A G 4: 101,798,788 (GRCm39) E253G probably damaging Het
Prickle4 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 17: 48,000,806 (GRCm39) probably benign Het
Prokr1 G A 6: 87,565,678 (GRCm39) R56W probably benign Het
Ptprz1 G A 6: 23,024,957 (GRCm39) C1731Y probably damaging Het
Rbm15b A T 9: 106,763,028 (GRCm39) F380Y possibly damaging Het
Rfc5 G A 5: 117,524,885 (GRCm39) L56F probably damaging Het
Rhpn2 A T 7: 35,090,228 (GRCm39) M617L probably benign Het
Rusc1 T C 3: 88,995,577 (GRCm39) probably null Het
Sec23ip A G 7: 128,354,634 (GRCm39) N297D probably damaging Het
Sema3c A T 5: 17,880,157 (GRCm39) H259L probably benign Het
Sgsm1 G A 5: 113,428,328 (GRCm39) probably benign Het
Shisal2a A G 4: 108,224,998 (GRCm39) V188A probably benign Het
Sipa1l2 T A 8: 126,218,606 (GRCm39) S244C probably damaging Het
Slc39a5 T C 10: 128,234,316 (GRCm39) I196V probably benign Het
Smim22 G A 16: 4,825,722 (GRCm39) A36T probably damaging Het
Spag6 A G 2: 18,747,588 (GRCm39) I408V probably benign Het
Sult2a5 A G 7: 13,359,311 (GRCm39) I96V probably benign Het
Tmcc2 C A 1: 132,308,517 (GRCm39) A126S probably benign Het
Tsc2 A T 17: 24,819,009 (GRCm39) S1276T probably damaging Het
Ttc21a A G 9: 119,788,103 (GRCm39) S843G probably benign Het
Tubd1 G C 11: 86,443,621 (GRCm39) V110L possibly damaging Het
Ugt1a2 T A 1: 88,128,534 (GRCm39) V59D probably damaging Het
Vmn2r-ps158 A G 7: 42,697,024 (GRCm39) R687G probably damaging Het
Vsig8 T A 1: 172,389,142 (GRCm39) H131Q probably benign Het
Zbtb42 C A 12: 112,646,861 (GRCm39) Y345* probably null Het
Zfp612 T A 8: 110,816,576 (GRCm39) C594* probably null Het
Zfp940 A G 7: 29,544,824 (GRCm39) V361A probably benign Het
Other mutations in Or5m12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01632:Or5m12 APN 2 85,734,714 (GRCm39) missense probably benign
IGL02108:Or5m12 APN 2 85,734,494 (GRCm39) missense possibly damaging 0.67
IGL02738:Or5m12 APN 2 85,735,293 (GRCm39) missense probably benign 0.06
IGL03343:Or5m12 APN 2 85,735,285 (GRCm39) missense probably benign
IGL02802:Or5m12 UTSW 2 85,734,733 (GRCm39) missense probably damaging 1.00
R0265:Or5m12 UTSW 2 85,734,591 (GRCm39) missense probably benign 0.01
R0271:Or5m12 UTSW 2 85,734,633 (GRCm39) missense possibly damaging 0.68
R0432:Or5m12 UTSW 2 85,734,501 (GRCm39) missense probably damaging 1.00
R0501:Or5m12 UTSW 2 85,735,348 (GRCm39) missense probably damaging 1.00
R0504:Or5m12 UTSW 2 85,735,030 (GRCm39) missense possibly damaging 0.95
R1513:Or5m12 UTSW 2 85,735,015 (GRCm39) missense probably damaging 1.00
R2224:Or5m12 UTSW 2 85,735,099 (GRCm39) missense probably benign 0.11
R2516:Or5m12 UTSW 2 85,734,900 (GRCm39) missense probably benign 0.01
R3845:Or5m12 UTSW 2 85,735,081 (GRCm39) missense probably damaging 0.99
R4871:Or5m12 UTSW 2 85,734,715 (GRCm39) missense probably benign
R4889:Or5m12 UTSW 2 85,735,092 (GRCm39) missense possibly damaging 0.48
R5543:Or5m12 UTSW 2 85,734,672 (GRCm39) missense probably damaging 1.00
R5865:Or5m12 UTSW 2 85,734,865 (GRCm39) missense probably benign 0.00
R6254:Or5m12 UTSW 2 85,734,849 (GRCm39) missense probably damaging 1.00
R6331:Or5m12 UTSW 2 85,734,560 (GRCm39) missense probably benign 0.32
R6465:Or5m12 UTSW 2 85,734,883 (GRCm39) missense probably benign 0.05
R7183:Or5m12 UTSW 2 85,734,486 (GRCm39) missense probably benign 0.00
R7427:Or5m12 UTSW 2 85,734,475 (GRCm39) nonsense probably null
R7428:Or5m12 UTSW 2 85,734,475 (GRCm39) nonsense probably null
R7552:Or5m12 UTSW 2 85,734,447 (GRCm39) missense probably benign 0.01
R7654:Or5m12 UTSW 2 85,734,663 (GRCm39) missense possibly damaging 0.95
R7674:Or5m12 UTSW 2 85,734,880 (GRCm39) missense probably damaging 1.00
R7980:Or5m12 UTSW 2 85,734,942 (GRCm39) missense probably benign 0.22
R8209:Or5m12 UTSW 2 85,734,547 (GRCm39) missense probably benign 0.14
R8226:Or5m12 UTSW 2 85,734,547 (GRCm39) missense probably benign 0.14
Z1177:Or5m12 UTSW 2 85,735,389 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTGTTGGGTCCACAAAAGG -3'
(R):5'- TGACTGGGAACTTTGGCATGATC -3'

Sequencing Primer
(F):5'- GAAGTCAATATCACCTGCATTGTGCC -3'
(R):5'- GGCATGATCTTATTAATCAGGTTCAC -3'
Posted On 2016-03-17