Incidental Mutation 'R0304:Olfr1223'
ID37724
Institutional Source Beutler Lab
Gene Symbol Olfr1223
Ensembl Gene ENSMUSG00000075100
Gene Nameolfactory receptor 1223
SynonymsMOR233-10, GA_x6K02T2Q125-50623664-50622729
MMRRC Submission 038515-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0304 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89143508-89151560 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 89144764 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 86 (Y86*)
Ref Sequence ENSEMBL: ENSMUSP00000150550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099793] [ENSMUST00000217342]
Predicted Effect probably null
Transcript: ENSMUST00000099793
AA Change: Y86*
SMART Domains Protein: ENSMUSP00000097381
Gene: ENSMUSG00000075099
AA Change: Y86*

DomainStartEndE-ValueType
Pfam:7tm_1 39 286 2e-26 PFAM
Pfam:7tm_4 138 283 5.6e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111554
AA Change: Y86*
SMART Domains Protein: ENSMUSP00000107179
Gene: ENSMUSG00000075100
AA Change: Y86*

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.1e-48 PFAM
Pfam:7tm_1 39 286 1.6e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217342
AA Change: Y86*
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik C T 4: 144,520,049 T55I probably benign Het
Acod1 T A 14: 103,054,982 I314N probably damaging Het
Actl11 T A 9: 107,929,768 V430E probably damaging Het
Adam19 A C 11: 46,127,392 D427A possibly damaging Het
Adarb2 C T 13: 8,752,570 probably benign Het
Akap7 A T 10: 25,271,552 H93Q probably damaging Het
Ankrd36 C A 11: 5,628,981 R82S possibly damaging Het
Arhgap21 A T 2: 20,859,801 probably benign Het
Atm T A 9: 53,516,344 I489F probably benign Het
AU019823 T C 9: 50,607,922 D130G probably damaging Het
Carmil1 T C 13: 24,139,341 S243G probably damaging Het
Cdc42bpg T C 19: 6,317,248 V939A probably damaging Het
Cel A C 2: 28,557,771 L377R probably benign Het
Clock A G 5: 76,226,985 V779A unknown Het
Cluap1 G A 16: 3,929,918 probably benign Het
Ctif A T 18: 75,521,818 H212Q probably benign Het
Cyp4a29 T A 4: 115,252,932 probably benign Het
Cytip T C 2: 58,148,246 N101S possibly damaging Het
D130043K22Rik T C 13: 24,864,815 M434T probably benign Het
Ddx47 A G 6: 135,017,220 I154V possibly damaging Het
Dnah6 C T 6: 73,159,115 E1014K probably damaging Het
Dnajc27 T G 12: 4,106,793 probably benign Het
Drc7 A T 8: 95,059,128 D204V probably damaging Het
Dsc3 A G 18: 19,981,241 Y319H probably damaging Het
Eml6 T C 11: 29,777,441 Q1227R probably benign Het
Enpp2 A T 15: 54,877,806 D365E probably benign Het
Ercc2 T C 7: 19,386,708 I199T possibly damaging Het
Exd2 G A 12: 80,491,240 probably benign Het
F2 A T 2: 91,633,233 I128N probably damaging Het
Fam219b T C 9: 57,538,876 L123P probably damaging Het
Fasn A G 11: 120,819,936 V299A possibly damaging Het
Fastkd2 T C 1: 63,752,400 V689A possibly damaging Het
Fbxw13 C T 9: 109,194,721 R85Q probably benign Het
Fer1l6 A G 15: 58,590,562 Y822C probably benign Het
Fhl5 T C 4: 25,207,241 T176A probably benign Het
Gm20530 T G 17: 36,094,226 noncoding transcript Het
Gm4787 A T 12: 81,378,934 I150N probably damaging Het
Grip1 G A 10: 120,075,471 S618N probably benign Het
Hdac9 T C 12: 34,374,111 K454E probably damaging Het
Iars2 T A 1: 185,287,156 I978F possibly damaging Het
Icosl A G 10: 78,075,322 Y299C probably benign Het
Idi1 T C 13: 8,890,357 Y192H probably damaging Het
Iqub T G 6: 24,454,291 Q531P probably damaging Het
Itih4 T A 14: 30,890,094 probably null Het
Izumo4 A T 10: 80,702,936 H71L probably damaging Het
Jcad A T 18: 4,673,325 E362D possibly damaging Het
Kif21a G T 15: 90,976,521 probably null Het
Kynu A T 2: 43,679,881 I392F probably damaging Het
Luc7l2 A G 6: 38,592,776 E223G probably damaging Het
Map3k8 A C 18: 4,339,552 L273R probably damaging Het
Max A G 12: 76,938,587 L119P probably benign Het
Mphosph9 T C 5: 124,298,829 N484S probably benign Het
Mrgprg A G 7: 143,765,055 Y107H probably damaging Het
Mrps31 A T 8: 22,421,338 I199F probably benign Het
Mtr C G 13: 12,222,154 probably null Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nptx2 A G 5: 144,553,650 probably benign Het
Nrip1 T C 16: 76,292,707 Q654R possibly damaging Het
Ocm A G 5: 144,024,534 F30L probably damaging Het
Olfr1216 G A 2: 89,013,288 R259W probably damaging Het
Olfr297 C T 7: 86,526,987 P77S probably damaging Het
Olfr600 G T 7: 103,346,711 D72E probably damaging Het
Oosp1 T C 19: 11,690,969 M17V probably benign Het
Pax1 A T 2: 147,366,147 Y225F probably benign Het
Pde4dip T A 3: 97,843,712 H62L probably benign Het
Pkd1 C A 17: 24,585,946 Q3190K probably damaging Het
Pkn1 A C 8: 83,683,607 probably benign Het
Plin5 T C 17: 56,115,597 D113G probably damaging Het
Ppfia1 A G 7: 144,482,345 V1141A probably damaging Het
Ppp4r1 T A 17: 65,816,006 D334E probably benign Het
Ptov1 A T 7: 44,863,449 probably null Het
Rab22a G A 2: 173,661,459 V22M probably damaging Het
Rictor T A 15: 6,786,371 probably null Het
Sart1 G T 19: 5,380,531 probably benign Het
Scn11a G A 9: 119,819,862 A45V probably benign Het
Serpina5 A G 12: 104,103,200 T224A possibly damaging Het
Siglecf G T 7: 43,352,401 G212C probably damaging Het
Slc38a4 A T 15: 97,008,454 M378K probably damaging Het
Spata22 T A 11: 73,340,449 C176* probably null Het
Tmc3 G A 7: 83,596,139 E131K probably damaging Het
Trappc10 A T 10: 78,210,760 probably benign Het
Uvrag A G 7: 98,887,973 F672L probably benign Het
Vmn1r121 A G 7: 21,098,407 V36A possibly damaging Het
Vmn1r13 A T 6: 57,210,626 M257L probably benign Het
Vmn1r58 C T 7: 5,410,496 C245Y probably damaging Het
Vmn1r86 C A 7: 13,102,780 M56I probably benign Het
Wdr62 T C 7: 30,242,874 Y1051C probably benign Het
Xpnpep3 A G 15: 81,430,714 D205G probably damaging Het
Zdhhc14 T C 17: 5,725,336 probably benign Het
Zfp607a A T 7: 27,879,212 D569V possibly damaging Het
Zfp609 C T 9: 65,701,188 E1137K possibly damaging Het
Zfp871 T C 17: 32,774,434 Y589C probably damaging Het
Zzef1 A T 11: 72,880,624 D1644V probably benign Het
Other mutations in Olfr1223
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Olfr1223 APN 2 89144231 missense possibly damaging 0.55
IGL01560:Olfr1223 APN 2 89144603 missense probably damaging 1.00
IGL01817:Olfr1223 APN 2 89144358 missense probably benign 0.01
IGL02669:Olfr1223 APN 2 89144220 nonsense probably null
IGL03270:Olfr1223 APN 2 89144745 missense probably damaging 0.98
R0062:Olfr1223 UTSW 2 89144622 missense possibly damaging 0.95
R0062:Olfr1223 UTSW 2 89144622 missense possibly damaging 0.95
R1651:Olfr1223 UTSW 2 89145002 missense probably damaging 1.00
R1971:Olfr1223 UTSW 2 89144734 nonsense probably null
R2006:Olfr1223 UTSW 2 89144897 missense probably benign 0.21
R2101:Olfr1223 UTSW 2 89144957 missense probably benign 0.03
R2410:Olfr1223 UTSW 2 89144555 missense possibly damaging 0.88
R3683:Olfr1223 UTSW 2 89145020 start codon destroyed probably null 1.00
R3685:Olfr1223 UTSW 2 89145020 start codon destroyed probably null 1.00
R3939:Olfr1223 UTSW 2 89144130 nonsense probably null
R6162:Olfr1223 UTSW 2 89144770 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAATGCAAGAAGCCTCCTGCC -3'
(R):5'- AAAGTCATCCTGTGCCCTTTGGTC -3'

Sequencing Primer
(F):5'- GGCTATCCCTACCAGAATGAC -3'
(R):5'- ACTTCTGGGACTTTCACAGAAC -3'
Posted On2013-05-23