Mutagenetix > Incidental Mutation

Incidental Mutation 'R4890:Cit'

377249

Institutional Source

Beutler Lab

Gene Symbol

Cit

Ensembl Gene

ENSMUSG00000029516

Gene Name

citron

Synonyms

CRIK-SK, C030025P15Rik, Cit-k, citron-N, citron kinase

MMRRC Submission

042495-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R4890 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115845278-116008947 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

C to T at 115988123 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000115802 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000141101]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000051704

SMART Domains

Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
low complexity region	632	646	N/A	INTRINSIC
low complexity region	891	905	N/A	INTRINSIC
low complexity region	915	948	N/A	INTRINSIC
low complexity region	950	968	N/A	INTRINSIC
low complexity region	1068	1081	N/A	INTRINSIC
low complexity region	1138	1156	N/A	INTRINSIC
low complexity region	1182	1203	N/A	INTRINSIC
internal_repeat_1	1243	1282	1.05e-5	PROSPERO
low complexity region	1353	1364	N/A	INTRINSIC
C1	1389	1437	1.97e-9	SMART
PH	1470	1591	1.31e-8	SMART
CNH	1618	1915	1.78e-112	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102560

SMART Domains

Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
coiled coil region	452	1244	N/A	INTRINSIC
coiled coil region	1297	1338	N/A	INTRINSIC
low complexity region	1368	1379	N/A	INTRINSIC
C1	1404	1452	1.97e-9	SMART
PH	1485	1606	1.31e-8	SMART
CNH	1633	1930	1.78e-112	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112008

SMART Domains

Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
coiled coil region	452	1202	N/A	INTRINSIC
coiled coil region	1255	1296	N/A	INTRINSIC
low complexity region	1326	1337	N/A	INTRINSIC
C1	1362	1410	1.97e-9	SMART
PH	1443	1564	1.31e-8	SMART
CNH	1591	1888	1.78e-112	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122877

Predicted Effect

probably benign
Transcript: ENSMUST00000123736

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134609

Predicted Effect

probably benign
Transcript: ENSMUST00000141101

SMART Domains

Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516

Domain	Start	End	E-Value	Type
S_TKc	97	359	1.4e-91	SMART
S_TK_X	360	422	3e-18	SMART
low complexity region	632	646	N/A	INTRINSIC
low complexity region	686	698	N/A	INTRINSIC
low complexity region	849	863	N/A	INTRINSIC
low complexity region	873	906	N/A	INTRINSIC
low complexity region	908	926	N/A	INTRINSIC
low complexity region	1026	1039	N/A	INTRINSIC
low complexity region	1096	1114	N/A	INTRINSIC
low complexity region	1140	1161	N/A	INTRINSIC
internal_repeat_1	1201	1240	1.73e-5	PROSPERO
low complexity region	1311	1322	N/A	INTRINSIC
C1	1347	1395	9.7e-12	SMART
PH	1428	1549	6e-11	SMART
CNH	1576	1873	8.6e-115	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145363

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147479

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.4%

Validation Efficiency

99% (81/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700080E11Rik	A	T	9: 105,144,587	S87T	possibly damaging	Het
AA986860	T	C	1: 130,740,988		probably benign	Het
Adcy4	C	T	14: 55,779,029	D322N	probably damaging	Het
Adgrb3	T	C	1: 25,221,827	N916S	probably damaging	Het
AI464131	G	A	4: 41,498,877	T251M	probably benign	Het
Aox2	T	C	1: 58,334,703	V841A	probably benign	Het
Baz2b	A	T	2: 59,926,039	M983K	probably damaging	Het
BC027072	C	T	17: 71,752,311	V124I	possibly damaging	Het
C2cd2l	A	G	9: 44,311,133	F682L	probably damaging	Het
Ccsap	T	G	8: 123,845,421	E114A	possibly damaging	Het
Cept1	T	A	3: 106,505,807	T201S	probably damaging	Het
Cfap221	T	C	1: 119,955,746	M232V	probably benign	Het
Chsy1	A	G	7: 66,110,226	R106G	probably benign	Het
Cldn7	G	A	11: 69,967,092	V42I	probably benign	Het
Cnnm4	T	A	1: 36,472,264	V191E	probably benign	Het
Cntf	A	T	19: 12,763,962	V178D	possibly damaging	Het
Ctsz	C	A	2: 174,428,600	R263L	probably damaging	Het
Dclk1	T	C	3: 55,521,932	M407T	probably benign	Het
Dennd1a	A	T	2: 38,176,226		probably benign	Het
Dnhd1	A	G	7: 105,656,957	I368V	possibly damaging	Het
Fam159a	A	G	4: 108,367,801	V188A	probably benign	Het
Gak	A	T	5: 108,580,876		probably benign	Het
Gm12794	A	G	4: 101,941,591	E253G	probably damaging	Het
Gm9268	A	G	7: 43,047,600	R687G	probably damaging	Het
Hepacam2	A	T	6: 3,487,231	V42D	probably damaging	Het
Il1rl2	CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT	CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT	1: 40,327,310		probably benign	Het
Insr	T	A	8: 3,198,234	Q437L	probably benign	Het
Itga8	G	A	2: 12,193,291		probably benign	Het
Kansl1	A	T	11: 104,343,042	C732S	probably benign	Het
Kdsr	T	C	1: 106,753,234	K78R	probably benign	Het
Kif14	T	C	1: 136,487,130	S785P	possibly damaging	Het
Lbr	C	A	1: 181,817,568	L506F	probably benign	Het
Macf1	C	A	4: 123,448,238	C2720F	probably damaging	Het
Mapt	G	A	11: 104,328,149	D738N	probably damaging	Het
Mroh9	T	C	1: 163,026,524	Y769C	probably damaging	Het
Mylk2	A	G	2: 152,920,354	N515S	possibly damaging	Het
Nek10	T	A	14: 14,860,986	L513M	possibly damaging	Het
Nrxn2	A	T	19: 6,448,278	S258C	possibly damaging	Het
Olfr1024	C	T	2: 85,904,748	C102Y	possibly damaging	Het
Olfr1346	T	A	7: 6,474,849	C246*	probably null	Het
Olfr672	G	A	7: 104,996,104	H267Y	probably benign	Het
Olfr786	C	T	10: 129,437,079	T89I	probably benign	Het
Olfr893	G	T	9: 38,209,290	C79F	probably benign	Het
Osgin2	G	A	4: 16,013,739		probably benign	Het
Otud3	G	A	4: 138,913,749	R27W	probably damaging	Het
Pcdhga12	T	A	18: 37,768,237	F707L	possibly damaging	Het
Pik3r1	T	C	13: 101,757,610	E17G	probably damaging	Het
Prickle4	AAGAGAGAGAGAGAGA	AAGAGAGAGAGAGA	17: 47,689,881		probably benign	Het
Prokr1	G	A	6: 87,588,696	R56W	probably benign	Het
Ptprz1	G	A	6: 23,024,958	C1731Y	probably damaging	Het
Rbm15b	A	T	9: 106,885,829	F380Y	possibly damaging	Het
Rfc5	G	A	5: 117,386,820	L56F	probably damaging	Het
Rhpn2	A	T	7: 35,390,803	M617L	probably benign	Het
Rusc1	T	C	3: 89,088,270		probably null	Het
Sec23ip	A	G	7: 128,752,910	N297D	probably damaging	Het
Sema3c	A	T	5: 17,675,159	H259L	probably benign	Het
Sgsm1	G	A	5: 113,280,462		probably benign	Het
Sipa1l2	T	A	8: 125,491,867	S244C	probably damaging	Het
Slc39a5	T	C	10: 128,398,447	I196V	probably benign	Het
Smim22	G	A	16: 5,007,858	A36T	probably damaging	Het
Spag6	A	G	2: 18,742,777	I408V	probably benign	Het
Sult2a5	A	G	7: 13,625,386	I96V	probably benign	Het
Tmcc2	C	A	1: 132,380,779	A126S	probably benign	Het
Tsc2	A	T	17: 24,600,035	S1276T	probably damaging	Het
Ttc21a	A	G	9: 119,959,037	S843G	probably benign	Het
Tubd1	G	C	11: 86,552,795	V110L	possibly damaging	Het
Ugt1a2	T	A	1: 88,200,812	V59D	probably damaging	Het
Vsig8	T	A	1: 172,561,575	H131Q	probably benign	Het
Zbtb42	C	A	12: 112,680,427	Y345*	probably null	Het
Zfp612	T	A	8: 110,089,944	C594*	probably null	Het
Zfp940	A	G	7: 29,845,399	V361A	probably benign	Het

Other mutations in Cit

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Cit	APN	5	115846465	missense	probably damaging	0.99
IGL00482:Cit	APN	5	115938755	missense	probably damaging	0.97
IGL01317:Cit	APN	5	115908716	missense	probably benign	0.03
IGL01335:Cit	APN	5	115908830	splice site	probably benign
IGL01415:Cit	APN	5	115941903	missense	possibly damaging	0.78
IGL01447:Cit	APN	5	115873843	splice site	probably benign
IGL01537:Cit	APN	5	115933854	missense	probably benign	0.00
IGL01621:Cit	APN	5	115992603	splice site	probably benign
IGL02010:Cit	APN	5	115875947	missense	probably damaging	1.00
IGL02538:Cit	APN	5	115986989	nonsense	probably null
IGL02607:Cit	APN	5	115859209	missense	probably benign
IGL02720:Cit	APN	5	115995452	missense	probably benign	0.26
IGL02725:Cit	APN	5	115985473	missense	probably benign	0.02
IGL02967:Cit	APN	5	115945837	missense	probably benign	0.11
IGL02973:Cit	APN	5	116005999	missense	possibly damaging	0.73
IGL03383:Cit	APN	5	115873845	splice site	probably benign
PIT4514001:Cit	UTSW	5	115997854	critical splice donor site	probably null
R0206:Cit	UTSW	5	115994030	missense	possibly damaging	0.72
R0206:Cit	UTSW	5	115994030	missense	possibly damaging	0.72
R0226:Cit	UTSW	5	115984840	missense	probably damaging	0.99
R0320:Cit	UTSW	5	115979445	missense	possibly damaging	0.87
R0401:Cit	UTSW	5	115985479	missense	probably benign	0.06
R0480:Cit	UTSW	5	115933393	splice site	probably benign
R0609:Cit	UTSW	5	115873943	missense	probably damaging	0.98
R0737:Cit	UTSW	5	115946919	missense	probably damaging	1.00
R1238:Cit	UTSW	5	115851221	missense	probably benign	0.30
R1503:Cit	UTSW	5	115873900	missense	possibly damaging	0.94
R1551:Cit	UTSW	5	115945842	missense	probably benign	0.00
R1602:Cit	UTSW	5	115997730	missense	probably damaging	1.00
R1720:Cit	UTSW	5	115967897	missense	probably damaging	0.98
R1854:Cit	UTSW	5	115873901	missense	probably damaging	1.00
R1886:Cit	UTSW	5	115933486	missense	probably damaging	1.00
R2024:Cit	UTSW	5	115947924	missense	probably damaging	0.97
R2024:Cit	UTSW	5	116005840	missense	probably damaging	0.97
R2048:Cit	UTSW	5	115886813	splice site	probably null
R2128:Cit	UTSW	5	115985507	missense	possibly damaging	0.63
R2192:Cit	UTSW	5	115968009	missense	probably benign	0.00
R2244:Cit	UTSW	5	115926505	missense	probably damaging	1.00
R2518:Cit	UTSW	5	115987046	missense	probably damaging	0.99
R2679:Cit	UTSW	5	115969115	missense	probably benign	0.00
R2898:Cit	UTSW	5	115873978	splice site	probably null
R2908:Cit	UTSW	5	115981676	missense	probably benign	0.00
R3079:Cit	UTSW	5	115925486	missense	probably damaging	0.97
R3779:Cit	UTSW	5	115859341	missense	probably benign	0.01
R4081:Cit	UTSW	5	115948050	missense	probably damaging	1.00
R4494:Cit	UTSW	5	115873984	missense	probably damaging	1.00
R4610:Cit	UTSW	5	115994087	missense	probably benign	0.01
R4757:Cit	UTSW	5	115997549	missense	probably damaging	1.00
R4788:Cit	UTSW	5	115933506	missense	probably damaging	1.00
R4816:Cit	UTSW	5	115908691	missense	probably damaging	1.00
R4899:Cit	UTSW	5	115863028	missense	possibly damaging	0.60
R4928:Cit	UTSW	5	115985797	missense	probably benign	0.00
R5073:Cit	UTSW	5	115946843	missense	probably benign	0.24
R5151:Cit	UTSW	5	115979835	missense	probably damaging	1.00
R5154:Cit	UTSW	5	115988405	missense	probably damaging	1.00
R5222:Cit	UTSW	5	115952543	missense	probably benign	0.03
R5814:Cit	UTSW	5	115979419	missense	probably damaging	1.00
R5935:Cit	UTSW	5	115925539	intron	probably benign
R5946:Cit	UTSW	5	115997534	missense	probably damaging	1.00
R6051:Cit	UTSW	5	115846405	missense	probably benign
R6289:Cit	UTSW	5	116006326	makesense	probably null
R6298:Cit	UTSW	5	115948065	missense	probably damaging	1.00
R6362:Cit	UTSW	5	115886676	missense	probably benign	0.01
R6545:Cit	UTSW	5	115846434	missense	probably null	0.00
R6761:Cit	UTSW	5	115908675	missense	probably damaging	1.00
R6798:Cit	UTSW	5	115926526	missense	possibly damaging	0.56
R6814:Cit	UTSW	5	115884963	missense	probably damaging	1.00
R6825:Cit	UTSW	5	115981774	missense	probably damaging	0.99
R6845:Cit	UTSW	5	115984888	missense	probably damaging	1.00
R6983:Cit	UTSW	5	115994091	missense	probably damaging	1.00
R7164:Cit	UTSW	5	115985787	missense	possibly damaging	0.94
R7359:Cit	UTSW	5	115926574	missense	probably damaging	1.00
R7597:Cit	UTSW	5	115886681	nonsense	probably null
R7729:Cit	UTSW	5	115984822	missense	possibly damaging	0.87
R7763:Cit	UTSW	5	115987001	missense	probably benign	0.01
R7786:Cit	UTSW	5	115863018	missense	probably benign	0.00
R7799:Cit	UTSW	5	115862968	missense	probably benign	0.00
R8060:Cit	UTSW	5	115908727	missense	probably benign	0.00
R8068:Cit	UTSW	5	115952466	missense	probably damaging	1.00
R8068:Cit	UTSW	5	115982235	missense	probably benign	0.03
R8122:Cit	UTSW	5	115969010	missense	probably damaging	1.00
R8177:Cit	UTSW	5	115988159	missense	probably benign	0.18
R8178:Cit	UTSW	5	115969072	missense	probably damaging	1.00
R8265:Cit	UTSW	5	115988177	missense	probably damaging	1.00
R8359:Cit	UTSW	5	115984544	splice site	probably null
R8397:Cit	UTSW	5	115886797	missense	probably benign
R8489:Cit	UTSW	5	115945903	critical splice donor site	probably null
R8784:Cit	UTSW	5	115846383	nonsense	probably null
R8798:Cit	UTSW	5	115969043	missense	probably damaging	0.99
R8882:Cit	UTSW	5	115863030	missense	probably benign	0.04
R8984:Cit	UTSW	5	115926475	missense	possibly damaging	0.86
R9091:Cit	UTSW	5	115846102	intron	probably benign
R9127:Cit	UTSW	5	115936837	nonsense	probably null
R9204:Cit	UTSW	5	115988439	missense	probably damaging	0.99
R9212:Cit	UTSW	5	115875893	missense	possibly damaging	0.75
R9279:Cit	UTSW	5	115927911	missense	probably damaging	1.00
R9288:Cit	UTSW	5	115985453	missense	probably damaging	1.00
R9377:Cit	UTSW	5	115946855	missense	probably benign	0.04
R9520:Cit	UTSW	5	115941895	nonsense	probably null
Z1088:Cit	UTSW	5	115985533	missense	possibly damaging	0.62
Z1176:Cit	UTSW	5	115986603	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTAGGTCACCCACTTGTGTG -3'
(R):5'- CATCCTGACAGCGTGTGGTC -3'

Sequencing Primer
(F):5'- GTCTGCACCAAGCTAATTTAGGGC -3'
(R):5'- TCCCAGCTGACCGACTGTG -3'

Posted On

2016-03-17