Incidental Mutation 'R4890:Ptprz1'
ID377253
Institutional Source Beutler Lab
Gene Symbol Ptprz1
Ensembl Gene ENSMUSG00000068748
Gene Nameprotein tyrosine phosphatase, receptor type Z, polypeptide 1
SynonymsPTPzeta, RPTPz, phosphacan, Rptpbeta, DSD-1-PG, PTPbeta, Ptprz, Ptpz
MMRRC Submission 042495-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.713) question?
Stock #R4890 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location22875502-23052916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23024958 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 1731 (C1731Y)
Ref Sequence ENSEMBL: ENSMUSP00000088056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090568] [ENSMUST00000202102]
Predicted Effect probably damaging
Transcript: ENSMUST00000090568
AA Change: C1731Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088056
Gene: ENSMUSG00000068748
AA Change: C1731Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Carb_anhydrase 38 300 5.12e-99 SMART
FN3 312 397 5.53e-4 SMART
low complexity region 588 609 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
low complexity region 1417 1441 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
Blast:PTPc 1497 1573 1e-12 BLAST
low complexity region 1606 1620 N/A INTRINSIC
transmembrane domain 1637 1659 N/A INTRINSIC
low complexity region 1679 1693 N/A INTRINSIC
PTPc 1720 1991 2.8e-130 SMART
PTPc 2019 2281 1.65e-77 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202102
AA Change: C882Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143902
Gene: ENSMUSG00000068748
AA Change: C882Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Carb_anhydrase 38 300 5.12e-99 SMART
FN3 312 397 5.53e-4 SMART
low complexity region 588 609 N/A INTRINSIC
transmembrane domain 788 810 N/A INTRINSIC
low complexity region 830 844 N/A INTRINSIC
PTPc 871 1142 2.8e-130 SMART
PTPc 1170 1432 1.65e-77 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine phosphatase family. Expression of this gene is restricted to the central nervous system (CNS), and it may be involved in the regulation of specific developmental processes in the CNS. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for targeted null mutations demonstrate an impaired ability to recover from inflamatory lesions of the CNS or gastric mucosa. Mice homozygous for a knock-out allele exhibit increased tactile and thermal nociception thresholds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,587 S87T possibly damaging Het
AA986860 T C 1: 130,740,988 probably benign Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Adgrb3 T C 1: 25,221,827 N916S probably damaging Het
AI464131 G A 4: 41,498,877 T251M probably benign Het
Aox2 T C 1: 58,334,703 V841A probably benign Het
Baz2b A T 2: 59,926,039 M983K probably damaging Het
BC027072 C T 17: 71,752,311 V124I possibly damaging Het
C2cd2l A G 9: 44,311,133 F682L probably damaging Het
Ccsap T G 8: 123,845,421 E114A possibly damaging Het
Cept1 T A 3: 106,505,807 T201S probably damaging Het
Cfap221 T C 1: 119,955,746 M232V probably benign Het
Chsy1 A G 7: 66,110,226 R106G probably benign Het
Cit C T 5: 115,988,123 probably benign Het
Cldn7 G A 11: 69,967,092 V42I probably benign Het
Cnnm4 T A 1: 36,472,264 V191E probably benign Het
Cntf A T 19: 12,763,962 V178D possibly damaging Het
Ctsz C A 2: 174,428,600 R263L probably damaging Het
Dclk1 T C 3: 55,521,932 M407T probably benign Het
Dennd1a A T 2: 38,176,226 probably benign Het
Dnhd1 A G 7: 105,656,957 I368V possibly damaging Het
Fam159a A G 4: 108,367,801 V188A probably benign Het
Gak A T 5: 108,580,876 probably benign Het
Gm12794 A G 4: 101,941,591 E253G probably damaging Het
Gm9268 A G 7: 43,047,600 R687G probably damaging Het
Hepacam2 A T 6: 3,487,231 V42D probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Insr T A 8: 3,198,234 Q437L probably benign Het
Itga8 G A 2: 12,193,291 probably benign Het
Kansl1 A T 11: 104,343,042 C732S probably benign Het
Kdsr T C 1: 106,753,234 K78R probably benign Het
Kif14 T C 1: 136,487,130 S785P possibly damaging Het
Lbr C A 1: 181,817,568 L506F probably benign Het
Macf1 C A 4: 123,448,238 C2720F probably damaging Het
Mapt G A 11: 104,328,149 D738N probably damaging Het
Mroh9 T C 1: 163,026,524 Y769C probably damaging Het
Mylk2 A G 2: 152,920,354 N515S possibly damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nrxn2 A T 19: 6,448,278 S258C possibly damaging Het
Olfr1024 C T 2: 85,904,748 C102Y possibly damaging Het
Olfr1346 T A 7: 6,474,849 C246* probably null Het
Olfr672 G A 7: 104,996,104 H267Y probably benign Het
Olfr786 C T 10: 129,437,079 T89I probably benign Het
Olfr893 G T 9: 38,209,290 C79F probably benign Het
Osgin2 G A 4: 16,013,739 probably benign Het
Otud3 G A 4: 138,913,749 R27W probably damaging Het
Pcdhga12 T A 18: 37,768,237 F707L possibly damaging Het
Pik3r1 T C 13: 101,757,610 E17G probably damaging Het
Prickle4 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 17: 47,689,881 probably benign Het
Prokr1 G A 6: 87,588,696 R56W probably benign Het
Rbm15b A T 9: 106,885,829 F380Y possibly damaging Het
Rfc5 G A 5: 117,386,820 L56F probably damaging Het
Rhpn2 A T 7: 35,390,803 M617L probably benign Het
Rusc1 T C 3: 89,088,270 probably null Het
Sec23ip A G 7: 128,752,910 N297D probably damaging Het
Sema3c A T 5: 17,675,159 H259L probably benign Het
Sgsm1 G A 5: 113,280,462 probably benign Het
Sipa1l2 T A 8: 125,491,867 S244C probably damaging Het
Slc39a5 T C 10: 128,398,447 I196V probably benign Het
Smim22 G A 16: 5,007,858 A36T probably damaging Het
Spag6 A G 2: 18,742,777 I408V probably benign Het
Sult2a5 A G 7: 13,625,386 I96V probably benign Het
Tmcc2 C A 1: 132,380,779 A126S probably benign Het
Tsc2 A T 17: 24,600,035 S1276T probably damaging Het
Ttc21a A G 9: 119,959,037 S843G probably benign Het
Tubd1 G C 11: 86,552,795 V110L possibly damaging Het
Ugt1a2 T A 1: 88,200,812 V59D probably damaging Het
Vsig8 T A 1: 172,561,575 H131Q probably benign Het
Zbtb42 C A 12: 112,680,427 Y345* probably null Het
Zfp612 T A 8: 110,089,944 C594* probably null Het
Zfp940 A G 7: 29,845,399 V361A probably benign Het
Other mutations in Ptprz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Ptprz1 APN 6 22973054 missense probably damaging 1.00
IGL00773:Ptprz1 APN 6 23002629 missense probably benign 0.41
IGL01458:Ptprz1 APN 6 22972844 missense probably damaging 0.99
IGL01481:Ptprz1 APN 6 22999980 missense probably benign 0.05
IGL01501:Ptprz1 APN 6 22973082 missense probably damaging 1.00
IGL01601:Ptprz1 APN 6 23000438 missense probably damaging 0.99
IGL01882:Ptprz1 APN 6 23000464 missense probably damaging 1.00
IGL02058:Ptprz1 APN 6 23002503 missense probably benign 0.00
IGL02089:Ptprz1 APN 6 23033448 missense probably damaging 1.00
IGL02136:Ptprz1 APN 6 22972822 missense probably damaging 1.00
IGL02215:Ptprz1 APN 6 22965182 missense possibly damaging 0.91
IGL02220:Ptprz1 APN 6 23042743 splice site probably benign
IGL02556:Ptprz1 APN 6 22972845 missense probably benign 0.01
IGL02601:Ptprz1 APN 6 23000687 missense probably benign 0.11
IGL02620:Ptprz1 APN 6 22959740 missense probably damaging 1.00
IGL02666:Ptprz1 APN 6 23001210 missense probably benign 0.00
IGL02718:Ptprz1 APN 6 23001349 missense possibly damaging 0.77
IGL02792:Ptprz1 APN 6 22959723 missense probably damaging 1.00
IGL02894:Ptprz1 APN 6 23035149 missense probably damaging 1.00
IGL02952:Ptprz1 APN 6 23036926 missense probably damaging 1.00
IGL03003:Ptprz1 APN 6 23002583 missense probably damaging 0.98
IGL03060:Ptprz1 APN 6 22972835 missense probably damaging 1.00
IGL03170:Ptprz1 APN 6 22959767 missense probably benign 0.00
IGL03246:Ptprz1 APN 6 22986160 missense probably damaging 0.99
IGL03349:Ptprz1 APN 6 23000332 missense probably damaging 1.00
IGL03365:Ptprz1 APN 6 23030582 splice site probably benign
R0044:Ptprz1 UTSW 6 23007403 missense probably damaging 1.00
R0054:Ptprz1 UTSW 6 22986196 missense probably damaging 1.00
R0054:Ptprz1 UTSW 6 22986196 missense probably damaging 1.00
R0107:Ptprz1 UTSW 6 23000570 missense probably damaging 0.98
R0278:Ptprz1 UTSW 6 23000817 missense probably benign 0.31
R0345:Ptprz1 UTSW 6 23016165 missense probably damaging 1.00
R0359:Ptprz1 UTSW 6 22973176 splice site probably benign
R0743:Ptprz1 UTSW 6 23044367 nonsense probably null
R1014:Ptprz1 UTSW 6 23000644 missense probably damaging 1.00
R1016:Ptprz1 UTSW 6 23000974 missense probably damaging 1.00
R1106:Ptprz1 UTSW 6 22965749 missense probably damaging 0.99
R1391:Ptprz1 UTSW 6 23001729 missense probably benign 0.33
R1424:Ptprz1 UTSW 6 23000383 missense probably benign 0.00
R1445:Ptprz1 UTSW 6 23050474 missense probably damaging 1.00
R1496:Ptprz1 UTSW 6 23049524 splice site probably benign
R1544:Ptprz1 UTSW 6 23000748 missense possibly damaging 0.63
R1626:Ptprz1 UTSW 6 23001574 missense probably benign
R1641:Ptprz1 UTSW 6 23049606 missense probably damaging 1.00
R1757:Ptprz1 UTSW 6 23044320 missense probably damaging 1.00
R1812:Ptprz1 UTSW 6 22959712 missense probably benign 0.07
R1917:Ptprz1 UTSW 6 23035040 splice site probably benign
R1930:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R1931:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R1974:Ptprz1 UTSW 6 22986311 missense probably damaging 1.00
R1992:Ptprz1 UTSW 6 22959748 missense probably benign 0.24
R1997:Ptprz1 UTSW 6 23050497 missense probably damaging 0.99
R2002:Ptprz1 UTSW 6 23027834 nonsense probably null
R2012:Ptprz1 UTSW 6 23001027 missense probably benign 0.03
R2059:Ptprz1 UTSW 6 22986323 splice site probably benign
R2061:Ptprz1 UTSW 6 23049675 critical splice donor site probably null
R2064:Ptprz1 UTSW 6 23050389 splice site probably benign
R2067:Ptprz1 UTSW 6 23050389 splice site probably benign
R2108:Ptprz1 UTSW 6 23033477 missense probably damaging 0.99
R2152:Ptprz1 UTSW 6 23030671 missense probably damaging 0.99
R2166:Ptprz1 UTSW 6 23045633 missense possibly damaging 0.90
R2183:Ptprz1 UTSW 6 23002285 missense probably benign
R2202:Ptprz1 UTSW 6 23000650 missense possibly damaging 0.63
R2238:Ptprz1 UTSW 6 22987377 missense probably damaging 1.00
R2290:Ptprz1 UTSW 6 23000991 missense probably damaging 1.00
R3027:Ptprz1 UTSW 6 23016197 missense possibly damaging 0.89
R3861:Ptprz1 UTSW 6 23036895 missense probably damaging 0.98
R4012:Ptprz1 UTSW 6 23002585 missense probably damaging 0.99
R4020:Ptprz1 UTSW 6 22959624 splice site probably benign
R4158:Ptprz1 UTSW 6 23001684 nonsense probably null
R4158:Ptprz1 UTSW 6 23022205 missense possibly damaging 0.73
R4159:Ptprz1 UTSW 6 23001684 nonsense probably null
R4160:Ptprz1 UTSW 6 23022205 missense possibly damaging 0.73
R4606:Ptprz1 UTSW 6 23001487 missense possibly damaging 0.80
R4621:Ptprz1 UTSW 6 23001454 missense possibly damaging 0.68
R4640:Ptprz1 UTSW 6 22972798 missense probably damaging 1.00
R4731:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4732:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4733:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4803:Ptprz1 UTSW 6 23001546 missense probably benign 0.00
R5035:Ptprz1 UTSW 6 23016215 missense probably benign 0.06
R5052:Ptprz1 UTSW 6 23045626 missense probably damaging 1.00
R5106:Ptprz1 UTSW 6 23000028 missense probably benign 0.04
R5248:Ptprz1 UTSW 6 23001901 missense probably benign 0.11
R5292:Ptprz1 UTSW 6 23002582 missense probably benign 0.31
R5373:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R5374:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R5378:Ptprz1 UTSW 6 23007402 missense probably damaging 1.00
R5408:Ptprz1 UTSW 6 23002600 missense probably damaging 1.00
R5479:Ptprz1 UTSW 6 23001666 missense probably benign
R5524:Ptprz1 UTSW 6 22986318 splice site probably null
R5527:Ptprz1 UTSW 6 23000053 missense possibly damaging 0.66
R5557:Ptprz1 UTSW 6 23001001 missense probably benign 0.04
R5654:Ptprz1 UTSW 6 22986134 missense probably damaging 1.00
R5655:Ptprz1 UTSW 6 22999773 missense probably benign 0.00
R5658:Ptprz1 UTSW 6 23016189 missense probably damaging 1.00
R5663:Ptprz1 UTSW 6 23035143 missense probably damaging 1.00
R5765:Ptprz1 UTSW 6 23000236 missense probably damaging 1.00
R5822:Ptprz1 UTSW 6 23001445 missense probably benign 0.01
R5837:Ptprz1 UTSW 6 23001418 missense probably benign 0.00
R6108:Ptprz1 UTSW 6 23045659 missense probably damaging 1.00
R6199:Ptprz1 UTSW 6 23002471 missense probably benign 0.01
R6245:Ptprz1 UTSW 6 23051990 missense probably damaging 1.00
R6257:Ptprz1 UTSW 6 22959640 missense probably damaging 1.00
R6488:Ptprz1 UTSW 6 23001517 nonsense probably null
R6606:Ptprz1 UTSW 6 23002501 missense probably benign 0.27
R6612:Ptprz1 UTSW 6 23052082 missense probably damaging 1.00
R6824:Ptprz1 UTSW 6 23002131 missense probably benign 0.05
R6834:Ptprz1 UTSW 6 22999633 missense probably benign 0.38
R6836:Ptprz1 UTSW 6 23030665 nonsense probably null
R6991:Ptprz1 UTSW 6 23002687 missense probably benign 0.00
R7044:Ptprz1 UTSW 6 23044346 missense probably damaging 1.00
R7048:Ptprz1 UTSW 6 22961623 missense probably benign 0.18
R7225:Ptprz1 UTSW 6 23000929 missense possibly damaging 0.61
R7284:Ptprz1 UTSW 6 23000098 missense probably damaging 1.00
R7360:Ptprz1 UTSW 6 23000907 missense probably damaging 1.00
R7501:Ptprz1 UTSW 6 23001747 nonsense probably null
R7515:Ptprz1 UTSW 6 23022267 missense probably damaging 1.00
R7538:Ptprz1 UTSW 6 22999896 missense possibly damaging 0.81
R7567:Ptprz1 UTSW 6 22959780 missense probably damaging 0.97
R7599:Ptprz1 UTSW 6 23002519 missense not run
R7611:Ptprz1 UTSW 6 23001220 missense probably benign
R7685:Ptprz1 UTSW 6 23024978 missense probably damaging 1.00
R7707:Ptprz1 UTSW 6 23002296 missense probably benign 0.00
R7733:Ptprz1 UTSW 6 23000384 missense probably benign 0.31
R7786:Ptprz1 UTSW 6 23036993 missense probably damaging 1.00
R7868:Ptprz1 UTSW 6 23000964 missense not run
R7882:Ptprz1 UTSW 6 23002257 missense probably benign 0.13
R7968:Ptprz1 UTSW 6 22959676 missense probably damaging 0.98
R8024:Ptprz1 UTSW 6 23042751 missense probably damaging 1.00
R8157:Ptprz1 UTSW 6 23002540 missense probably damaging 1.00
R8159:Ptprz1 UTSW 6 23001663 missense probably benign
Z1176:Ptprz1 UTSW 6 23051995 missense probably damaging 0.99
Z1177:Ptprz1 UTSW 6 22999840 missense possibly damaging 0.51
Z1177:Ptprz1 UTSW 6 23052024 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGTAAGGCATTATTTCACTGC -3'
(R):5'- ACTGAATCCATTGGCAGACAG -3'

Sequencing Primer
(F):5'- CACTGCATTTCCTTTTAGCCAAGAAG -3'
(R):5'- GACAGCGCAAGGACACCG -3'
Posted On2016-03-17