Incidental Mutation 'R4890:Zfp612'
ID377265
Institutional Source Beutler Lab
Gene Symbol Zfp612
Ensembl Gene ENSMUSG00000044676
Gene Namezinc finger protein 612
Synonyms
MMRRC Submission 042495-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4890 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location110079746-110092741 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 110089944 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 594 (C594*)
Ref Sequence ENSEMBL: ENSMUSP00000148717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058804] [ENSMUST00000165700] [ENSMUST00000212754]
Predicted Effect probably null
Transcript: ENSMUST00000058804
AA Change: C555*
SMART Domains Protein: ENSMUSP00000062474
Gene: ENSMUSG00000044676
AA Change: C555*

DomainStartEndE-ValueType
KRAB 11 71 2e-32 SMART
low complexity region 135 146 N/A INTRINSIC
ZnF_C2H2 225 247 1.45e-2 SMART
ZnF_C2H2 253 275 2.67e-1 SMART
ZnF_C2H2 281 303 1.4e-4 SMART
ZnF_C2H2 309 331 2.91e-2 SMART
ZnF_C2H2 337 359 3.16e-3 SMART
ZnF_C2H2 365 387 4.17e-3 SMART
ZnF_C2H2 393 415 1.82e-3 SMART
ZnF_C2H2 421 443 3.69e-4 SMART
ZnF_C2H2 449 471 3.69e-4 SMART
ZnF_C2H2 477 499 1.58e-3 SMART
ZnF_C2H2 505 527 4.87e-4 SMART
ZnF_C2H2 533 555 1.38e-3 SMART
ZnF_C2H2 561 583 5.06e-2 SMART
ZnF_C2H2 589 611 5.9e-3 SMART
ZnF_C2H2 617 639 9.44e-2 SMART
ZnF_C2H2 645 667 1.03e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165700
Predicted Effect probably null
Transcript: ENSMUST00000212754
AA Change: C594*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (81/82)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,587 S87T possibly damaging Het
AA986860 T C 1: 130,740,988 probably benign Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Adgrb3 T C 1: 25,221,827 N916S probably damaging Het
AI464131 G A 4: 41,498,877 T251M probably benign Het
Aox2 T C 1: 58,334,703 V841A probably benign Het
Baz2b A T 2: 59,926,039 M983K probably damaging Het
BC027072 C T 17: 71,752,311 V124I possibly damaging Het
C2cd2l A G 9: 44,311,133 F682L probably damaging Het
Ccsap T G 8: 123,845,421 E114A possibly damaging Het
Cept1 T A 3: 106,505,807 T201S probably damaging Het
Cfap221 T C 1: 119,955,746 M232V probably benign Het
Chsy1 A G 7: 66,110,226 R106G probably benign Het
Cit C T 5: 115,988,123 probably benign Het
Cldn7 G A 11: 69,967,092 V42I probably benign Het
Cnnm4 T A 1: 36,472,264 V191E probably benign Het
Cntf A T 19: 12,763,962 V178D possibly damaging Het
Ctsz C A 2: 174,428,600 R263L probably damaging Het
Dclk1 T C 3: 55,521,932 M407T probably benign Het
Dennd1a A T 2: 38,176,226 probably benign Het
Dnhd1 A G 7: 105,656,957 I368V possibly damaging Het
Fam159a A G 4: 108,367,801 V188A probably benign Het
Gak A T 5: 108,580,876 probably benign Het
Gm12794 A G 4: 101,941,591 E253G probably damaging Het
Gm9268 A G 7: 43,047,600 R687G probably damaging Het
Hepacam2 A T 6: 3,487,231 V42D probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Insr T A 8: 3,198,234 Q437L probably benign Het
Itga8 G A 2: 12,193,291 probably benign Het
Kansl1 A T 11: 104,343,042 C732S probably benign Het
Kdsr T C 1: 106,753,234 K78R probably benign Het
Kif14 T C 1: 136,487,130 S785P possibly damaging Het
Lbr C A 1: 181,817,568 L506F probably benign Het
Macf1 C A 4: 123,448,238 C2720F probably damaging Het
Mapt G A 11: 104,328,149 D738N probably damaging Het
Mroh9 T C 1: 163,026,524 Y769C probably damaging Het
Mylk2 A G 2: 152,920,354 N515S possibly damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nrxn2 A T 19: 6,448,278 S258C possibly damaging Het
Olfr1024 C T 2: 85,904,748 C102Y possibly damaging Het
Olfr1346 T A 7: 6,474,849 C246* probably null Het
Olfr672 G A 7: 104,996,104 H267Y probably benign Het
Olfr786 C T 10: 129,437,079 T89I probably benign Het
Olfr893 G T 9: 38,209,290 C79F probably benign Het
Osgin2 G A 4: 16,013,739 probably benign Het
Otud3 G A 4: 138,913,749 R27W probably damaging Het
Pcdhga12 T A 18: 37,768,237 F707L possibly damaging Het
Pik3r1 T C 13: 101,757,610 E17G probably damaging Het
Prickle4 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 17: 47,689,881 probably benign Het
Prokr1 G A 6: 87,588,696 R56W probably benign Het
Ptprz1 G A 6: 23,024,958 C1731Y probably damaging Het
Rbm15b A T 9: 106,885,829 F380Y possibly damaging Het
Rfc5 G A 5: 117,386,820 L56F probably damaging Het
Rhpn2 A T 7: 35,390,803 M617L probably benign Het
Rusc1 T C 3: 89,088,270 probably null Het
Sec23ip A G 7: 128,752,910 N297D probably damaging Het
Sema3c A T 5: 17,675,159 H259L probably benign Het
Sgsm1 G A 5: 113,280,462 probably benign Het
Sipa1l2 T A 8: 125,491,867 S244C probably damaging Het
Slc39a5 T C 10: 128,398,447 I196V probably benign Het
Smim22 G A 16: 5,007,858 A36T probably damaging Het
Spag6 A G 2: 18,742,777 I408V probably benign Het
Sult2a5 A G 7: 13,625,386 I96V probably benign Het
Tmcc2 C A 1: 132,380,779 A126S probably benign Het
Tsc2 A T 17: 24,600,035 S1276T probably damaging Het
Ttc21a A G 9: 119,959,037 S843G probably benign Het
Tubd1 G C 11: 86,552,795 V110L possibly damaging Het
Ugt1a2 T A 1: 88,200,812 V59D probably damaging Het
Vsig8 T A 1: 172,561,575 H131Q probably benign Het
Zbtb42 C A 12: 112,680,427 Y345* probably null Het
Zfp940 A G 7: 29,845,399 V361A probably benign Het
Other mutations in Zfp612
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Zfp612 UTSW 8 110090038 missense probably damaging 1.00
R1920:Zfp612 UTSW 8 110088463 missense probably benign 0.03
R2994:Zfp612 UTSW 8 110089417 missense probably damaging 1.00
R4281:Zfp612 UTSW 8 110090059 missense probably damaging 0.98
R4378:Zfp612 UTSW 8 110089051 missense possibly damaging 0.92
R4492:Zfp612 UTSW 8 110089297 missense probably damaging 0.99
R4748:Zfp612 UTSW 8 110088672 missense probably benign 0.37
R5200:Zfp612 UTSW 8 110089900 nonsense probably null
R5443:Zfp612 UTSW 8 110089595 missense possibly damaging 0.85
R5864:Zfp612 UTSW 8 110089726 missense probably damaging 1.00
R6177:Zfp612 UTSW 8 110089974 missense probably damaging 1.00
R6435:Zfp612 UTSW 8 110089320 missense probably damaging 0.99
R6601:Zfp612 UTSW 8 110089549 missense possibly damaging 0.92
R7082:Zfp612 UTSW 8 110089705 missense probably damaging 1.00
R7083:Zfp612 UTSW 8 110089136 missense probably damaging 1.00
RF007:Zfp612 UTSW 8 110089542 nonsense probably null
RF008:Zfp612 UTSW 8 110089561 missense probably damaging 1.00
Z1176:Zfp612 UTSW 8 110088863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGGGAAAGCTTTCAGTATC -3'
(R):5'- GTCTTCATTGTGAACATCTTGGTGC -3'

Sequencing Primer
(F):5'- GTGGGAAAGCTTTCAGTATCAATGCC -3'
(R):5'- GCTTAGTTGGAAGCTAAACCTG -3'
Posted On2016-03-17