Incidental Mutation 'R4890:Sipa1l2'
ID 377267
Institutional Source Beutler Lab
Gene Symbol Sipa1l2
Ensembl Gene ENSMUSG00000001995
Gene Name signal-induced proliferation-associated 1 like 2
Synonyms
MMRRC Submission 042495-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.318) question?
Stock # R4890 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 126144802-126296547 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 126218606 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 244 (S244C)
Ref Sequence ENSEMBL: ENSMUSP00000148536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]
AlphaFold Q80TE4
Predicted Effect probably damaging
Transcript: ENSMUST00000108775
AA Change: S244C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: S244C

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
Pfam:Rap_GAP 625 807 2.6e-67 PFAM
PDZ 960 1026 6.47e-9 SMART
low complexity region 1091 1103 N/A INTRINSIC
low complexity region 1120 1138 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
low complexity region 1299 1312 N/A INTRINSIC
low complexity region 1321 1329 N/A INTRINSIC
low complexity region 1334 1355 N/A INTRINSIC
low complexity region 1404 1418 N/A INTRINSIC
Pfam:SPAR_C 1421 1666 2.5e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212168
AA Change: S244C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212987
AA Change: S244C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0959 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T C 1: 130,668,725 (GRCm39) probably benign Het
Adcy4 C T 14: 56,016,486 (GRCm39) D322N probably damaging Het
Adgrb3 T C 1: 25,260,908 (GRCm39) N916S probably damaging Het
Aox1 T C 1: 58,373,862 (GRCm39) V841A probably benign Het
Baz2b A T 2: 59,756,383 (GRCm39) M983K probably damaging Het
C2cd2l A G 9: 44,222,430 (GRCm39) F682L probably damaging Het
Ccsap T G 8: 124,572,160 (GRCm39) E114A possibly damaging Het
Cept1 T A 3: 106,413,123 (GRCm39) T201S probably damaging Het
Cfap221 T C 1: 119,883,476 (GRCm39) M232V probably benign Het
Chsy1 A G 7: 65,759,974 (GRCm39) R106G probably benign Het
Cit C T 5: 116,126,182 (GRCm39) probably benign Het
Cldn7 G A 11: 69,857,918 (GRCm39) V42I probably benign Het
Cnnm4 T A 1: 36,511,345 (GRCm39) V191E probably benign Het
Cntf A T 19: 12,741,326 (GRCm39) V178D possibly damaging Het
Ctsz C A 2: 174,270,393 (GRCm39) R263L probably damaging Het
Dclk1 T C 3: 55,429,353 (GRCm39) M407T probably benign Het
Dennd1a A T 2: 38,066,238 (GRCm39) probably benign Het
Dnhd1 A G 7: 105,306,164 (GRCm39) I368V possibly damaging Het
Gak A T 5: 108,728,742 (GRCm39) probably benign Het
Hepacam2 A T 6: 3,487,231 (GRCm39) V42D probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,366,470 (GRCm39) probably benign Het
Insr T A 8: 3,248,234 (GRCm39) Q437L probably benign Het
Itga8 G A 2: 12,198,102 (GRCm39) probably benign Het
Kansl1 A T 11: 104,233,868 (GRCm39) C732S probably benign Het
Kdsr T C 1: 106,680,964 (GRCm39) K78R probably benign Het
Kif14 T C 1: 136,414,868 (GRCm39) S785P possibly damaging Het
Lbr C A 1: 181,645,133 (GRCm39) L506F probably benign Het
Macf1 C A 4: 123,342,031 (GRCm39) C2720F probably damaging Het
Mapt G A 11: 104,218,975 (GRCm39) D738N probably damaging Het
Mroh9 T C 1: 162,854,093 (GRCm39) Y769C probably damaging Het
Mylk2 A G 2: 152,762,274 (GRCm39) N515S possibly damaging Het
Myorg G A 4: 41,498,877 (GRCm39) T251M probably benign Het
Nek10 T A 14: 14,860,986 (GRCm38) L513M possibly damaging Het
Nrxn2 A T 19: 6,498,308 (GRCm39) S258C possibly damaging Het
Nudt16l2 A T 9: 105,021,786 (GRCm39) S87T possibly damaging Het
Or52e15 G A 7: 104,645,311 (GRCm39) H267Y probably benign Het
Or5m12 C T 2: 85,735,092 (GRCm39) C102Y possibly damaging Het
Or6c1b C T 10: 129,272,948 (GRCm39) T89I probably benign Het
Or6z5 T A 7: 6,477,848 (GRCm39) C246* probably null Het
Or8c15 G T 9: 38,120,586 (GRCm39) C79F probably benign Het
Osgin2 G A 4: 16,013,739 (GRCm39) probably benign Het
Otud3 G A 4: 138,641,060 (GRCm39) R27W probably damaging Het
Pcare C T 17: 72,059,306 (GRCm39) V124I possibly damaging Het
Pcdhga12 T A 18: 37,901,290 (GRCm39) F707L possibly damaging Het
Pik3r1 T C 13: 101,894,118 (GRCm39) E17G probably damaging Het
Pramel19 A G 4: 101,798,788 (GRCm39) E253G probably damaging Het
Prickle4 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 17: 48,000,806 (GRCm39) probably benign Het
Prokr1 G A 6: 87,565,678 (GRCm39) R56W probably benign Het
Ptprz1 G A 6: 23,024,957 (GRCm39) C1731Y probably damaging Het
Rbm15b A T 9: 106,763,028 (GRCm39) F380Y possibly damaging Het
Rfc5 G A 5: 117,524,885 (GRCm39) L56F probably damaging Het
Rhpn2 A T 7: 35,090,228 (GRCm39) M617L probably benign Het
Rusc1 T C 3: 88,995,577 (GRCm39) probably null Het
Sec23ip A G 7: 128,354,634 (GRCm39) N297D probably damaging Het
Sema3c A T 5: 17,880,157 (GRCm39) H259L probably benign Het
Sgsm1 G A 5: 113,428,328 (GRCm39) probably benign Het
Shisal2a A G 4: 108,224,998 (GRCm39) V188A probably benign Het
Slc39a5 T C 10: 128,234,316 (GRCm39) I196V probably benign Het
Smim22 G A 16: 4,825,722 (GRCm39) A36T probably damaging Het
Spag6 A G 2: 18,747,588 (GRCm39) I408V probably benign Het
Sult2a5 A G 7: 13,359,311 (GRCm39) I96V probably benign Het
Tmcc2 C A 1: 132,308,517 (GRCm39) A126S probably benign Het
Tsc2 A T 17: 24,819,009 (GRCm39) S1276T probably damaging Het
Ttc21a A G 9: 119,788,103 (GRCm39) S843G probably benign Het
Tubd1 G C 11: 86,443,621 (GRCm39) V110L possibly damaging Het
Ugt1a2 T A 1: 88,128,534 (GRCm39) V59D probably damaging Het
Vmn2r-ps158 A G 7: 42,697,024 (GRCm39) R687G probably damaging Het
Vsig8 T A 1: 172,389,142 (GRCm39) H131Q probably benign Het
Zbtb42 C A 12: 112,646,861 (GRCm39) Y345* probably null Het
Zfp612 T A 8: 110,816,576 (GRCm39) C594* probably null Het
Zfp940 A G 7: 29,544,824 (GRCm39) V361A probably benign Het
Other mutations in Sipa1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Sipa1l2 APN 8 126,218,545 (GRCm39) missense probably damaging 1.00
IGL00939:Sipa1l2 APN 8 126,191,174 (GRCm39) splice site probably benign
IGL00965:Sipa1l2 APN 8 126,174,613 (GRCm39) missense probably benign 0.02
IGL01321:Sipa1l2 APN 8 126,218,257 (GRCm39) missense probably damaging 1.00
IGL01450:Sipa1l2 APN 8 126,149,316 (GRCm39) critical splice donor site probably null
IGL01753:Sipa1l2 APN 8 126,180,031 (GRCm39) splice site probably benign
IGL01930:Sipa1l2 APN 8 126,145,978 (GRCm39) missense probably damaging 0.99
IGL02041:Sipa1l2 APN 8 126,218,558 (GRCm39) missense probably benign 0.03
IGL02215:Sipa1l2 APN 8 126,174,576 (GRCm39) missense possibly damaging 0.67
IGL02272:Sipa1l2 APN 8 126,218,750 (GRCm39) missense probably damaging 1.00
IGL02370:Sipa1l2 APN 8 126,207,008 (GRCm39) missense probably damaging 1.00
IGL02538:Sipa1l2 APN 8 126,178,716 (GRCm39) missense probably damaging 1.00
IGL02633:Sipa1l2 APN 8 126,174,507 (GRCm39) missense probably damaging 1.00
IGL03394:Sipa1l2 APN 8 126,218,398 (GRCm39) missense possibly damaging 0.67
Rebellious UTSW 8 126,195,078 (GRCm39) missense probably benign 0.01
R0144:Sipa1l2 UTSW 8 126,176,615 (GRCm39) splice site probably null
R0153:Sipa1l2 UTSW 8 126,148,637 (GRCm39) missense probably damaging 0.99
R0276:Sipa1l2 UTSW 8 126,148,679 (GRCm39) missense probably damaging 1.00
R0318:Sipa1l2 UTSW 8 126,174,436 (GRCm39) missense possibly damaging 0.73
R0373:Sipa1l2 UTSW 8 126,191,149 (GRCm39) missense probably damaging 0.99
R0427:Sipa1l2 UTSW 8 126,207,071 (GRCm39) missense probably damaging 1.00
R0634:Sipa1l2 UTSW 8 126,149,363 (GRCm39) nonsense probably null
R1377:Sipa1l2 UTSW 8 126,218,716 (GRCm39) missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 126,176,712 (GRCm39) missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 126,176,712 (GRCm39) missense probably damaging 1.00
R1435:Sipa1l2 UTSW 8 126,195,464 (GRCm39) missense probably damaging 1.00
R1523:Sipa1l2 UTSW 8 126,174,352 (GRCm39) missense possibly damaging 0.75
R1577:Sipa1l2 UTSW 8 126,219,001 (GRCm39) missense probably benign 0.00
R1581:Sipa1l2 UTSW 8 126,218,356 (GRCm39) missense probably damaging 0.96
R1583:Sipa1l2 UTSW 8 126,148,634 (GRCm39) missense probably damaging 0.97
R1719:Sipa1l2 UTSW 8 126,171,274 (GRCm39) missense probably damaging 0.99
R1730:Sipa1l2 UTSW 8 126,206,880 (GRCm39) splice site probably null
R1940:Sipa1l2 UTSW 8 126,206,887 (GRCm39) splice site probably benign
R2007:Sipa1l2 UTSW 8 126,166,176 (GRCm39) missense probably damaging 1.00
R2141:Sipa1l2 UTSW 8 126,218,230 (GRCm39) missense probably benign 0.07
R2203:Sipa1l2 UTSW 8 126,218,366 (GRCm39) missense probably damaging 0.99
R2764:Sipa1l2 UTSW 8 126,219,113 (GRCm39) missense probably damaging 0.99
R3722:Sipa1l2 UTSW 8 126,200,323 (GRCm39) missense probably damaging 1.00
R3787:Sipa1l2 UTSW 8 126,177,122 (GRCm39) missense possibly damaging 0.52
R3787:Sipa1l2 UTSW 8 126,149,944 (GRCm39) missense probably benign
R4106:Sipa1l2 UTSW 8 126,219,047 (GRCm39) missense probably damaging 1.00
R4117:Sipa1l2 UTSW 8 126,195,249 (GRCm39) missense probably damaging 1.00
R4194:Sipa1l2 UTSW 8 126,218,411 (GRCm39) missense probably benign 0.00
R4237:Sipa1l2 UTSW 8 126,218,395 (GRCm39) missense probably benign 0.44
R4240:Sipa1l2 UTSW 8 126,218,395 (GRCm39) missense probably benign 0.44
R4448:Sipa1l2 UTSW 8 126,219,094 (GRCm39) missense probably damaging 1.00
R4515:Sipa1l2 UTSW 8 126,218,965 (GRCm39) missense probably benign 0.00
R4519:Sipa1l2 UTSW 8 126,218,965 (GRCm39) missense probably benign 0.00
R4523:Sipa1l2 UTSW 8 126,219,163 (GRCm39) missense probably damaging 1.00
R4557:Sipa1l2 UTSW 8 126,191,154 (GRCm39) missense probably damaging 0.98
R4667:Sipa1l2 UTSW 8 126,180,209 (GRCm39) missense possibly damaging 0.93
R4687:Sipa1l2 UTSW 8 126,217,984 (GRCm39) missense probably damaging 1.00
R4854:Sipa1l2 UTSW 8 126,200,340 (GRCm39) missense probably damaging 1.00
R5065:Sipa1l2 UTSW 8 126,218,324 (GRCm39) missense probably benign 0.19
R5194:Sipa1l2 UTSW 8 126,166,012 (GRCm39) missense possibly damaging 0.48
R5266:Sipa1l2 UTSW 8 126,218,865 (GRCm39) missense probably damaging 0.99
R5475:Sipa1l2 UTSW 8 126,218,334 (GRCm39) missense probably damaging 1.00
R5718:Sipa1l2 UTSW 8 126,217,987 (GRCm39) missense probably damaging 1.00
R5910:Sipa1l2 UTSW 8 126,218,423 (GRCm39) missense probably benign 0.42
R5916:Sipa1l2 UTSW 8 126,195,312 (GRCm39) missense probably damaging 1.00
R5941:Sipa1l2 UTSW 8 126,200,275 (GRCm39) missense probably damaging 0.99
R6083:Sipa1l2 UTSW 8 126,195,212 (GRCm39) missense possibly damaging 0.87
R6185:Sipa1l2 UTSW 8 126,194,992 (GRCm39) nonsense probably null
R6235:Sipa1l2 UTSW 8 126,201,610 (GRCm39) missense probably damaging 1.00
R6274:Sipa1l2 UTSW 8 126,196,611 (GRCm39) missense probably damaging 1.00
R6299:Sipa1l2 UTSW 8 126,180,203 (GRCm39) missense possibly damaging 0.75
R6374:Sipa1l2 UTSW 8 126,171,369 (GRCm39) missense probably damaging 1.00
R6459:Sipa1l2 UTSW 8 126,171,223 (GRCm39) critical splice donor site probably null
R6462:Sipa1l2 UTSW 8 126,217,969 (GRCm39) missense probably damaging 1.00
R6496:Sipa1l2 UTSW 8 126,176,633 (GRCm39) missense probably benign 0.00
R6543:Sipa1l2 UTSW 8 126,177,101 (GRCm39) missense possibly damaging 0.50
R7154:Sipa1l2 UTSW 8 126,195,078 (GRCm39) missense probably benign 0.01
R7192:Sipa1l2 UTSW 8 126,149,348 (GRCm39) missense probably benign 0.09
R7240:Sipa1l2 UTSW 8 126,196,599 (GRCm39) missense probably damaging 1.00
R7361:Sipa1l2 UTSW 8 126,180,071 (GRCm39) missense probably damaging 1.00
R7383:Sipa1l2 UTSW 8 126,174,385 (GRCm39) missense probably damaging 1.00
R7417:Sipa1l2 UTSW 8 126,208,845 (GRCm39) missense possibly damaging 0.93
R7604:Sipa1l2 UTSW 8 126,146,011 (GRCm39) missense probably benign 0.45
R7658:Sipa1l2 UTSW 8 126,219,029 (GRCm39) missense probably benign 0.00
R7743:Sipa1l2 UTSW 8 126,190,972 (GRCm39) missense probably damaging 1.00
R7781:Sipa1l2 UTSW 8 126,218,566 (GRCm39) missense possibly damaging 0.46
R7812:Sipa1l2 UTSW 8 126,218,334 (GRCm39) missense probably damaging 1.00
R7829:Sipa1l2 UTSW 8 126,178,727 (GRCm39) missense probably damaging 1.00
R7880:Sipa1l2 UTSW 8 126,191,132 (GRCm39) missense probably damaging 1.00
R7884:Sipa1l2 UTSW 8 126,174,337 (GRCm39) missense probably benign
R8057:Sipa1l2 UTSW 8 126,195,269 (GRCm39) missense probably damaging 1.00
R8082:Sipa1l2 UTSW 8 126,218,548 (GRCm39) missense possibly damaging 0.82
R8092:Sipa1l2 UTSW 8 126,145,907 (GRCm39) missense probably benign 0.03
R8247:Sipa1l2 UTSW 8 126,149,372 (GRCm39) missense probably benign 0.29
R8252:Sipa1l2 UTSW 8 126,195,410 (GRCm39) missense probably damaging 1.00
R8386:Sipa1l2 UTSW 8 126,218,832 (GRCm39) missense probably damaging 1.00
R8466:Sipa1l2 UTSW 8 126,218,985 (GRCm39) missense probably damaging 1.00
R8697:Sipa1l2 UTSW 8 126,208,855 (GRCm39) missense probably damaging 1.00
R8725:Sipa1l2 UTSW 8 126,177,125 (GRCm39) missense probably benign 0.28
R8727:Sipa1l2 UTSW 8 126,177,125 (GRCm39) missense probably benign 0.28
R9048:Sipa1l2 UTSW 8 126,174,465 (GRCm39) missense possibly damaging 0.59
R9224:Sipa1l2 UTSW 8 126,218,716 (GRCm39) missense probably damaging 1.00
R9279:Sipa1l2 UTSW 8 126,208,896 (GRCm39) missense probably damaging 1.00
R9392:Sipa1l2 UTSW 8 126,194,960 (GRCm39) missense probably benign
R9574:Sipa1l2 UTSW 8 126,169,453 (GRCm39) missense probably benign
R9591:Sipa1l2 UTSW 8 126,219,112 (GRCm39) missense probably damaging 0.99
R9614:Sipa1l2 UTSW 8 126,196,565 (GRCm39) missense probably null 0.01
R9690:Sipa1l2 UTSW 8 126,218,996 (GRCm39) missense probably benign
X0027:Sipa1l2 UTSW 8 126,218,875 (GRCm39) missense probably damaging 1.00
Z1177:Sipa1l2 UTSW 8 126,174,295 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GAAGGTCTCATGCTCACTCTTG -3'
(R):5'- AGGATGTCCTGGACCAACAC -3'

Sequencing Primer
(F):5'- CACTCTTGACTGCCCGAAG -3'
(R):5'- TGGACCAACACGCAGTC -3'
Posted On 2016-03-17