Incidental Mutation 'R4890:Sipa1l2'
ID377267
Institutional Source Beutler Lab
Gene Symbol Sipa1l2
Ensembl Gene ENSMUSG00000001995
Gene Namesignal-induced proliferation-associated 1 like 2
Synonyms
MMRRC Submission 042495-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R4890 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location125418063-125569808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125491867 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 244 (S244C)
Ref Sequence ENSEMBL: ENSMUSP00000148536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]
Predicted Effect probably damaging
Transcript: ENSMUST00000108775
AA Change: S244C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: S244C

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
Pfam:Rap_GAP 625 807 2.6e-67 PFAM
PDZ 960 1026 6.47e-9 SMART
low complexity region 1091 1103 N/A INTRINSIC
low complexity region 1120 1138 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
low complexity region 1299 1312 N/A INTRINSIC
low complexity region 1321 1329 N/A INTRINSIC
low complexity region 1334 1355 N/A INTRINSIC
low complexity region 1404 1418 N/A INTRINSIC
Pfam:SPAR_C 1421 1666 2.5e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212168
AA Change: S244C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212987
AA Change: S244C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0959 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,587 S87T possibly damaging Het
AA986860 T C 1: 130,740,988 probably benign Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Adgrb3 T C 1: 25,221,827 N916S probably damaging Het
AI464131 G A 4: 41,498,877 T251M probably benign Het
Aox2 T C 1: 58,334,703 V841A probably benign Het
Baz2b A T 2: 59,926,039 M983K probably damaging Het
BC027072 C T 17: 71,752,311 V124I possibly damaging Het
C2cd2l A G 9: 44,311,133 F682L probably damaging Het
Ccsap T G 8: 123,845,421 E114A possibly damaging Het
Cept1 T A 3: 106,505,807 T201S probably damaging Het
Cfap221 T C 1: 119,955,746 M232V probably benign Het
Chsy1 A G 7: 66,110,226 R106G probably benign Het
Cit C T 5: 115,988,123 probably benign Het
Cldn7 G A 11: 69,967,092 V42I probably benign Het
Cnnm4 T A 1: 36,472,264 V191E probably benign Het
Cntf A T 19: 12,763,962 V178D possibly damaging Het
Ctsz C A 2: 174,428,600 R263L probably damaging Het
Dclk1 T C 3: 55,521,932 M407T probably benign Het
Dennd1a A T 2: 38,176,226 probably benign Het
Dnhd1 A G 7: 105,656,957 I368V possibly damaging Het
Fam159a A G 4: 108,367,801 V188A probably benign Het
Gak A T 5: 108,580,876 probably benign Het
Gm12794 A G 4: 101,941,591 E253G probably damaging Het
Gm9268 A G 7: 43,047,600 R687G probably damaging Het
Hepacam2 A T 6: 3,487,231 V42D probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Insr T A 8: 3,198,234 Q437L probably benign Het
Itga8 G A 2: 12,193,291 probably benign Het
Kansl1 A T 11: 104,343,042 C732S probably benign Het
Kdsr T C 1: 106,753,234 K78R probably benign Het
Kif14 T C 1: 136,487,130 S785P possibly damaging Het
Lbr C A 1: 181,817,568 L506F probably benign Het
Macf1 C A 4: 123,448,238 C2720F probably damaging Het
Mapt G A 11: 104,328,149 D738N probably damaging Het
Mroh9 T C 1: 163,026,524 Y769C probably damaging Het
Mylk2 A G 2: 152,920,354 N515S possibly damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nrxn2 A T 19: 6,448,278 S258C possibly damaging Het
Olfr1024 C T 2: 85,904,748 C102Y possibly damaging Het
Olfr1346 T A 7: 6,474,849 C246* probably null Het
Olfr672 G A 7: 104,996,104 H267Y probably benign Het
Olfr786 C T 10: 129,437,079 T89I probably benign Het
Olfr893 G T 9: 38,209,290 C79F probably benign Het
Osgin2 G A 4: 16,013,739 probably benign Het
Otud3 G A 4: 138,913,749 R27W probably damaging Het
Pcdhga12 T A 18: 37,768,237 F707L possibly damaging Het
Pik3r1 T C 13: 101,757,610 E17G probably damaging Het
Prickle4 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 17: 47,689,881 probably benign Het
Prokr1 G A 6: 87,588,696 R56W probably benign Het
Ptprz1 G A 6: 23,024,958 C1731Y probably damaging Het
Rbm15b A T 9: 106,885,829 F380Y possibly damaging Het
Rfc5 G A 5: 117,386,820 L56F probably damaging Het
Rhpn2 A T 7: 35,390,803 M617L probably benign Het
Rusc1 T C 3: 89,088,270 probably null Het
Sec23ip A G 7: 128,752,910 N297D probably damaging Het
Sema3c A T 5: 17,675,159 H259L probably benign Het
Sgsm1 G A 5: 113,280,462 probably benign Het
Slc39a5 T C 10: 128,398,447 I196V probably benign Het
Smim22 G A 16: 5,007,858 A36T probably damaging Het
Spag6 A G 2: 18,742,777 I408V probably benign Het
Sult2a5 A G 7: 13,625,386 I96V probably benign Het
Tmcc2 C A 1: 132,380,779 A126S probably benign Het
Tsc2 A T 17: 24,600,035 S1276T probably damaging Het
Ttc21a A G 9: 119,959,037 S843G probably benign Het
Tubd1 G C 11: 86,552,795 V110L possibly damaging Het
Ugt1a2 T A 1: 88,200,812 V59D probably damaging Het
Vsig8 T A 1: 172,561,575 H131Q probably benign Het
Zbtb42 C A 12: 112,680,427 Y345* probably null Het
Zfp612 T A 8: 110,089,944 C594* probably null Het
Zfp940 A G 7: 29,845,399 V361A probably benign Het
Other mutations in Sipa1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Sipa1l2 APN 8 125491806 missense probably damaging 1.00
IGL00939:Sipa1l2 APN 8 125464435 splice site probably benign
IGL00965:Sipa1l2 APN 8 125447874 missense probably benign 0.02
IGL01321:Sipa1l2 APN 8 125491518 missense probably damaging 1.00
IGL01450:Sipa1l2 APN 8 125422577 critical splice donor site probably null
IGL01753:Sipa1l2 APN 8 125453292 splice site probably benign
IGL01930:Sipa1l2 APN 8 125419239 missense probably damaging 0.99
IGL02041:Sipa1l2 APN 8 125491819 missense probably benign 0.03
IGL02215:Sipa1l2 APN 8 125447837 missense possibly damaging 0.67
IGL02272:Sipa1l2 APN 8 125492011 missense probably damaging 1.00
IGL02370:Sipa1l2 APN 8 125480269 missense probably damaging 1.00
IGL02538:Sipa1l2 APN 8 125451977 missense probably damaging 1.00
IGL02633:Sipa1l2 APN 8 125447768 missense probably damaging 1.00
IGL03394:Sipa1l2 APN 8 125491659 missense possibly damaging 0.67
Rebellious UTSW 8 125468339 missense probably benign 0.01
R0144:Sipa1l2 UTSW 8 125449876 splice site probably null
R0153:Sipa1l2 UTSW 8 125421898 missense probably damaging 0.99
R0276:Sipa1l2 UTSW 8 125421940 missense probably damaging 1.00
R0318:Sipa1l2 UTSW 8 125447697 missense possibly damaging 0.73
R0373:Sipa1l2 UTSW 8 125464410 missense probably damaging 0.99
R0427:Sipa1l2 UTSW 8 125480332 missense probably damaging 1.00
R0634:Sipa1l2 UTSW 8 125422624 nonsense probably null
R1377:Sipa1l2 UTSW 8 125491977 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1435:Sipa1l2 UTSW 8 125468725 missense probably damaging 1.00
R1523:Sipa1l2 UTSW 8 125447613 missense possibly damaging 0.75
R1577:Sipa1l2 UTSW 8 125492262 missense probably benign 0.00
R1581:Sipa1l2 UTSW 8 125491617 missense probably damaging 0.96
R1583:Sipa1l2 UTSW 8 125421895 missense probably damaging 0.97
R1719:Sipa1l2 UTSW 8 125444535 missense probably damaging 0.99
R1730:Sipa1l2 UTSW 8 125480141 splice site probably null
R1940:Sipa1l2 UTSW 8 125480148 splice site probably benign
R2007:Sipa1l2 UTSW 8 125439437 missense probably damaging 1.00
R2141:Sipa1l2 UTSW 8 125491491 missense probably benign 0.07
R2203:Sipa1l2 UTSW 8 125491627 missense probably damaging 0.99
R2764:Sipa1l2 UTSW 8 125492374 missense probably damaging 0.99
R3722:Sipa1l2 UTSW 8 125473584 missense probably damaging 1.00
R3787:Sipa1l2 UTSW 8 125423205 missense probably benign
R3787:Sipa1l2 UTSW 8 125450383 missense possibly damaging 0.52
R4106:Sipa1l2 UTSW 8 125492308 missense probably damaging 1.00
R4117:Sipa1l2 UTSW 8 125468510 missense probably damaging 1.00
R4194:Sipa1l2 UTSW 8 125491672 missense probably benign 0.00
R4237:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4240:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4448:Sipa1l2 UTSW 8 125492355 missense probably damaging 1.00
R4515:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4519:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4523:Sipa1l2 UTSW 8 125492424 missense probably damaging 1.00
R4557:Sipa1l2 UTSW 8 125464415 missense probably damaging 0.98
R4667:Sipa1l2 UTSW 8 125453470 missense possibly damaging 0.93
R4687:Sipa1l2 UTSW 8 125491245 missense probably damaging 1.00
R4854:Sipa1l2 UTSW 8 125473601 missense probably damaging 1.00
R5065:Sipa1l2 UTSW 8 125491585 missense probably benign 0.19
R5194:Sipa1l2 UTSW 8 125439273 missense possibly damaging 0.48
R5266:Sipa1l2 UTSW 8 125492126 missense probably damaging 0.99
R5475:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R5718:Sipa1l2 UTSW 8 125491248 missense probably damaging 1.00
R5910:Sipa1l2 UTSW 8 125491684 missense probably benign 0.42
R5916:Sipa1l2 UTSW 8 125468573 missense probably damaging 1.00
R5941:Sipa1l2 UTSW 8 125473536 missense probably damaging 0.99
R6083:Sipa1l2 UTSW 8 125468473 missense possibly damaging 0.87
R6185:Sipa1l2 UTSW 8 125468253 nonsense probably null
R6235:Sipa1l2 UTSW 8 125474871 missense probably damaging 1.00
R6274:Sipa1l2 UTSW 8 125469872 missense probably damaging 1.00
R6299:Sipa1l2 UTSW 8 125453464 missense possibly damaging 0.75
R6374:Sipa1l2 UTSW 8 125444630 missense probably damaging 1.00
R6459:Sipa1l2 UTSW 8 125444484 critical splice donor site probably null
R6462:Sipa1l2 UTSW 8 125491230 missense probably damaging 1.00
R6496:Sipa1l2 UTSW 8 125449894 missense probably benign 0.00
R6543:Sipa1l2 UTSW 8 125450362 missense possibly damaging 0.50
R7154:Sipa1l2 UTSW 8 125468339 missense probably benign 0.01
R7192:Sipa1l2 UTSW 8 125422609 missense probably benign 0.09
R7240:Sipa1l2 UTSW 8 125469860 missense probably damaging 1.00
R7361:Sipa1l2 UTSW 8 125453332 missense probably damaging 1.00
R7383:Sipa1l2 UTSW 8 125447646 missense probably damaging 1.00
R7417:Sipa1l2 UTSW 8 125482106 missense possibly damaging 0.93
R7604:Sipa1l2 UTSW 8 125419272 missense probably benign 0.45
R7658:Sipa1l2 UTSW 8 125492290 missense probably benign 0.00
R7743:Sipa1l2 UTSW 8 125464233 missense probably damaging 1.00
R7781:Sipa1l2 UTSW 8 125491827 missense possibly damaging 0.46
R7812:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R7829:Sipa1l2 UTSW 8 125451988 missense probably damaging 1.00
R7880:Sipa1l2 UTSW 8 125464393 missense probably damaging 1.00
R7884:Sipa1l2 UTSW 8 125447598 missense probably benign
R8057:Sipa1l2 UTSW 8 125468530 missense probably damaging 1.00
R8082:Sipa1l2 UTSW 8 125491809 missense possibly damaging 0.82
R8092:Sipa1l2 UTSW 8 125419168 missense probably benign 0.03
R8247:Sipa1l2 UTSW 8 125422633 missense probably benign 0.29
R8252:Sipa1l2 UTSW 8 125468671 missense probably damaging 1.00
R8386:Sipa1l2 UTSW 8 125492093 missense probably damaging 1.00
X0027:Sipa1l2 UTSW 8 125492136 missense probably damaging 1.00
Z1177:Sipa1l2 UTSW 8 125447556 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GAAGGTCTCATGCTCACTCTTG -3'
(R):5'- AGGATGTCCTGGACCAACAC -3'

Sequencing Primer
(F):5'- CACTCTTGACTGCCCGAAG -3'
(R):5'- TGGACCAACACGCAGTC -3'
Posted On2016-03-17