Incidental Mutation 'R4890:Ttc21a'
ID377272
Institutional Source Beutler Lab
Gene Symbol Ttc21a
Ensembl Gene ENSMUSG00000032514
Gene Nametetratricopeptide repeat domain 21A
SynonymsThm2, 4921538N17Rik
MMRRC Submission 042495-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R4890 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119937606-119967793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119959037 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 843 (S843G)
Ref Sequence ENSEMBL: ENSMUSP00000035100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035100] [ENSMUST00000177637]
Predicted Effect probably benign
Transcript: ENSMUST00000035100
AA Change: S843G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035100
Gene: ENSMUSG00000032514
AA Change: S843G

DomainStartEndE-ValueType
low complexity region 107 118 N/A INTRINSIC
Blast:TPR 214 247 6e-11 BLAST
TPR 326 359 4.55e1 SMART
TPR 494 527 1.97e1 SMART
Blast:TPR 528 561 1e-14 BLAST
TPR 565 598 2.63e1 SMART
Blast:TPR 617 649 6e-11 BLAST
TPR 721 754 1.33e0 SMART
TPR 755 788 4.84e-3 SMART
TPR 790 821 1.14e1 SMART
TPR 883 916 9.03e-3 SMART
low complexity region 921 935 N/A INTRINSIC
TPR 951 984 1.08e1 SMART
Blast:TPR 1022 1054 3e-12 BLAST
low complexity region 1117 1129 N/A INTRINSIC
TPR 1195 1228 2.22e-2 SMART
TPR 1264 1297 9.73e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161967
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Meta Mutation Damage Score 0.0714 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (81/82)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,587 S87T possibly damaging Het
AA986860 T C 1: 130,740,988 probably benign Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Adgrb3 T C 1: 25,221,827 N916S probably damaging Het
AI464131 G A 4: 41,498,877 T251M probably benign Het
Aox2 T C 1: 58,334,703 V841A probably benign Het
Baz2b A T 2: 59,926,039 M983K probably damaging Het
BC027072 C T 17: 71,752,311 V124I possibly damaging Het
C2cd2l A G 9: 44,311,133 F682L probably damaging Het
Ccsap T G 8: 123,845,421 E114A possibly damaging Het
Cept1 T A 3: 106,505,807 T201S probably damaging Het
Cfap221 T C 1: 119,955,746 M232V probably benign Het
Chsy1 A G 7: 66,110,226 R106G probably benign Het
Cit C T 5: 115,988,123 probably benign Het
Cldn7 G A 11: 69,967,092 V42I probably benign Het
Cnnm4 T A 1: 36,472,264 V191E probably benign Het
Cntf A T 19: 12,763,962 V178D possibly damaging Het
Ctsz C A 2: 174,428,600 R263L probably damaging Het
Dclk1 T C 3: 55,521,932 M407T probably benign Het
Dennd1a A T 2: 38,176,226 probably benign Het
Dnhd1 A G 7: 105,656,957 I368V possibly damaging Het
Fam159a A G 4: 108,367,801 V188A probably benign Het
Gak A T 5: 108,580,876 probably benign Het
Gm12794 A G 4: 101,941,591 E253G probably damaging Het
Gm9268 A G 7: 43,047,600 R687G probably damaging Het
Hepacam2 A T 6: 3,487,231 V42D probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Insr T A 8: 3,198,234 Q437L probably benign Het
Itga8 G A 2: 12,193,291 probably benign Het
Kansl1 A T 11: 104,343,042 C732S probably benign Het
Kdsr T C 1: 106,753,234 K78R probably benign Het
Kif14 T C 1: 136,487,130 S785P possibly damaging Het
Lbr C A 1: 181,817,568 L506F probably benign Het
Macf1 C A 4: 123,448,238 C2720F probably damaging Het
Mapt G A 11: 104,328,149 D738N probably damaging Het
Mroh9 T C 1: 163,026,524 Y769C probably damaging Het
Mylk2 A G 2: 152,920,354 N515S possibly damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nrxn2 A T 19: 6,448,278 S258C possibly damaging Het
Olfr1024 C T 2: 85,904,748 C102Y possibly damaging Het
Olfr1346 T A 7: 6,474,849 C246* probably null Het
Olfr672 G A 7: 104,996,104 H267Y probably benign Het
Olfr786 C T 10: 129,437,079 T89I probably benign Het
Olfr893 G T 9: 38,209,290 C79F probably benign Het
Osgin2 G A 4: 16,013,739 probably benign Het
Otud3 G A 4: 138,913,749 R27W probably damaging Het
Pcdhga12 T A 18: 37,768,237 F707L possibly damaging Het
Pik3r1 T C 13: 101,757,610 E17G probably damaging Het
Prickle4 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 17: 47,689,881 probably benign Het
Prokr1 G A 6: 87,588,696 R56W probably benign Het
Ptprz1 G A 6: 23,024,958 C1731Y probably damaging Het
Rbm15b A T 9: 106,885,829 F380Y possibly damaging Het
Rfc5 G A 5: 117,386,820 L56F probably damaging Het
Rhpn2 A T 7: 35,390,803 M617L probably benign Het
Rusc1 T C 3: 89,088,270 probably null Het
Sec23ip A G 7: 128,752,910 N297D probably damaging Het
Sema3c A T 5: 17,675,159 H259L probably benign Het
Sgsm1 G A 5: 113,280,462 probably benign Het
Sipa1l2 T A 8: 125,491,867 S244C probably damaging Het
Slc39a5 T C 10: 128,398,447 I196V probably benign Het
Smim22 G A 16: 5,007,858 A36T probably damaging Het
Spag6 A G 2: 18,742,777 I408V probably benign Het
Sult2a5 A G 7: 13,625,386 I96V probably benign Het
Tmcc2 C A 1: 132,380,779 A126S probably benign Het
Tsc2 A T 17: 24,600,035 S1276T probably damaging Het
Tubd1 G C 11: 86,552,795 V110L possibly damaging Het
Ugt1a2 T A 1: 88,200,812 V59D probably damaging Het
Vsig8 T A 1: 172,561,575 H131Q probably benign Het
Zbtb42 C A 12: 112,680,427 Y345* probably null Het
Zfp612 T A 8: 110,089,944 C594* probably null Het
Zfp940 A G 7: 29,845,399 V361A probably benign Het
Other mutations in Ttc21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Ttc21a APN 9 119965819 missense probably damaging 0.96
IGL01996:Ttc21a APN 9 119958116 missense probably damaging 0.99
IGL02160:Ttc21a APN 9 119956923 missense probably damaging 1.00
IGL02163:Ttc21a APN 9 119950835 nonsense probably null
IGL02252:Ttc21a APN 9 119956928 missense probably damaging 1.00
IGL02901:Ttc21a APN 9 119958281 missense probably damaging 0.98
IGL03105:Ttc21a APN 9 119942576 missense probably benign 0.01
IGL03155:Ttc21a APN 9 119943976 critical splice donor site probably null
IGL03323:Ttc21a APN 9 119940536 intron probably benign
R0054:Ttc21a UTSW 9 119943940 missense probably damaging 1.00
R0398:Ttc21a UTSW 9 119954562 missense probably damaging 1.00
R0452:Ttc21a UTSW 9 119939154 intron probably benign
R0541:Ttc21a UTSW 9 119956826 intron probably benign
R0545:Ttc21a UTSW 9 119958799 missense probably damaging 0.99
R0605:Ttc21a UTSW 9 119961842 missense possibly damaging 0.93
R1352:Ttc21a UTSW 9 119954652 missense possibly damaging 0.49
R1417:Ttc21a UTSW 9 119954261 missense probably damaging 0.99
R1471:Ttc21a UTSW 9 119942641 missense probably damaging 1.00
R1479:Ttc21a UTSW 9 119956947 missense probably benign 0.00
R1631:Ttc21a UTSW 9 119954162 splice site probably null
R1905:Ttc21a UTSW 9 119966757 missense possibly damaging 0.82
R2141:Ttc21a UTSW 9 119964295 missense probably damaging 0.98
R2213:Ttc21a UTSW 9 119940461 missense probably benign 0.01
R2265:Ttc21a UTSW 9 119959008 missense possibly damaging 0.62
R2327:Ttc21a UTSW 9 119966123 missense probably damaging 1.00
R2656:Ttc21a UTSW 9 119941265 missense probably damaging 0.98
R3000:Ttc21a UTSW 9 119952254 missense probably benign 0.02
R3792:Ttc21a UTSW 9 119954165 missense probably damaging 1.00
R3938:Ttc21a UTSW 9 119950816 intron probably benign
R4232:Ttc21a UTSW 9 119942618 missense probably benign 0.00
R4492:Ttc21a UTSW 9 119941280 missense probably benign 0.00
R4498:Ttc21a UTSW 9 119958819 missense possibly damaging 0.82
R4655:Ttc21a UTSW 9 119961762 missense possibly damaging 0.80
R4960:Ttc21a UTSW 9 119945001 missense possibly damaging 0.51
R4972:Ttc21a UTSW 9 119944961 missense probably benign 0.00
R5015:Ttc21a UTSW 9 119966129 missense probably damaging 0.98
R5092:Ttc21a UTSW 9 119942665 missense probably benign 0.01
R5117:Ttc21a UTSW 9 119966565 missense possibly damaging 0.64
R5123:Ttc21a UTSW 9 119952212 missense probably benign 0.04
R5452:Ttc21a UTSW 9 119950971 missense probably benign 0.00
R5733:Ttc21a UTSW 9 119941261 missense probably benign
R5734:Ttc21a UTSW 9 119966666 missense probably benign
R5869:Ttc21a UTSW 9 119958792 missense probably benign 0.03
R6214:Ttc21a UTSW 9 119966772 missense probably damaging 1.00
R6215:Ttc21a UTSW 9 119966772 missense probably damaging 1.00
R6279:Ttc21a UTSW 9 119961839 missense possibly damaging 0.78
R6284:Ttc21a UTSW 9 119943962 missense probably damaging 1.00
R6300:Ttc21a UTSW 9 119961839 missense possibly damaging 0.78
R6800:Ttc21a UTSW 9 119941202 missense possibly damaging 0.61
R6833:Ttc21a UTSW 9 119942635 missense probably benign 0.24
R7009:Ttc21a UTSW 9 119958073 nonsense probably null
R7060:Ttc21a UTSW 9 119966676 missense probably damaging 0.98
R7170:Ttc21a UTSW 9 119945541 missense probably damaging 0.99
R7418:Ttc21a UTSW 9 119959051 missense probably benign 0.01
R7438:Ttc21a UTSW 9 119945539 missense probably damaging 1.00
R7595:Ttc21a UTSW 9 119958069 missense probably benign 0.12
R7703:Ttc21a UTSW 9 119959029 missense probably benign 0.14
R8076:Ttc21a UTSW 9 119966326 missense probably benign 0.01
R8217:Ttc21a UTSW 9 119954628 missense probably benign 0.00
RF004:Ttc21a UTSW 9 119966772 missense probably damaging 1.00
Z1177:Ttc21a UTSW 9 119942680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCCTCCTCAAGCTGAAG -3'
(R):5'- CTTTCAATGCAGACAGCCGC -3'

Sequencing Primer
(F):5'- TGGCATCGGAACTCGTTC -3'
(R):5'- TGCGGCTGTAACACCTCAGATC -3'
Posted On2016-03-17