Incidental Mutation 'R4890:Kansl1'
ID377279
Institutional Source Beutler Lab
Gene Symbol Kansl1
Ensembl Gene ENSMUSG00000018412
Gene NameKAT8 regulatory NSL complex subunit 1
Synonyms1700081L11Rik
MMRRC Submission 042495-MU
Accession Numbers

Genbank: NM_001081045.1; Ensembl: ENSMUST00000018556, ENSMUST00000035872, ENSMUST00000106971, ENSMUST00000106972, ENSMUST00000106974, ENSMUST00000106977, ENSMUST00000134266, ENSMUST00000166536

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4890 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104333229-104468861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104343042 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 732 (C732S)
Ref Sequence ENSEMBL: ENSMUSP00000102585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018556] [ENSMUST00000106971] [ENSMUST00000106972] [ENSMUST00000106977]
Predicted Effect probably benign
Transcript: ENSMUST00000018556
SMART Domains Protein: ENSMUSP00000018556
Gene: ENSMUSG00000018412

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 759 772 N/A INTRINSIC
PEHE 816 966 1.53e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069188
Predicted Effect probably benign
Transcript: ENSMUST00000106971
AA Change: C732S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102584
Gene: ENSMUSG00000018412
AA Change: C732S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 822 835 N/A INTRINSIC
PEHE 879 1029 1.53e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106972
AA Change: C732S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102585
Gene: ENSMUSG00000018412
AA Change: C732S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 822 835 N/A INTRINSIC
PEHE 879 1029 1.53e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106977
SMART Domains Protein: ENSMUSP00000102590
Gene: ENSMUSG00000018412

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 759 772 N/A INTRINSIC
PEHE 816 966 1.53e-53 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is a subunit of two protein complexes involved with histone acetylation, the MLL1 complex and the NSL1 complex. The corresponding protein in Drosophila interacts with K(lysine) acetyltransferase 8, which is also a subunit of both the MLL1 and NSL1 complexes. [provided by RefSeq, Jun 2012]
Allele List at MGI

All alleles(136) : Gene trapped(136)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,587 S87T possibly damaging Het
AA986860 T C 1: 130,740,988 probably benign Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Adgrb3 T C 1: 25,221,827 N916S probably damaging Het
AI464131 G A 4: 41,498,877 T251M probably benign Het
Aox2 T C 1: 58,334,703 V841A probably benign Het
Baz2b A T 2: 59,926,039 M983K probably damaging Het
BC027072 C T 17: 71,752,311 V124I possibly damaging Het
C2cd2l A G 9: 44,311,133 F682L probably damaging Het
Ccsap T G 8: 123,845,421 E114A possibly damaging Het
Cept1 T A 3: 106,505,807 T201S probably damaging Het
Cfap221 T C 1: 119,955,746 M232V probably benign Het
Chsy1 A G 7: 66,110,226 R106G probably benign Het
Cit C T 5: 115,988,123 probably benign Het
Cldn7 G A 11: 69,967,092 V42I probably benign Het
Cnnm4 T A 1: 36,472,264 V191E probably benign Het
Cntf A T 19: 12,763,962 V178D possibly damaging Het
Ctsz C A 2: 174,428,600 R263L probably damaging Het
Dclk1 T C 3: 55,521,932 M407T probably benign Het
Dennd1a A T 2: 38,176,226 probably benign Het
Dnhd1 A G 7: 105,656,957 I368V possibly damaging Het
Fam159a A G 4: 108,367,801 V188A probably benign Het
Gak A T 5: 108,580,876 probably benign Het
Gm12794 A G 4: 101,941,591 E253G probably damaging Het
Gm9268 A G 7: 43,047,600 R687G probably damaging Het
Hepacam2 A T 6: 3,487,231 V42D probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Insr T A 8: 3,198,234 Q437L probably benign Het
Itga8 G A 2: 12,193,291 probably benign Het
Kdsr T C 1: 106,753,234 K78R probably benign Het
Kif14 T C 1: 136,487,130 S785P possibly damaging Het
Lbr C A 1: 181,817,568 L506F probably benign Het
Macf1 C A 4: 123,448,238 C2720F probably damaging Het
Mapt G A 11: 104,328,149 D738N probably damaging Het
Mroh9 T C 1: 163,026,524 Y769C probably damaging Het
Mylk2 A G 2: 152,920,354 N515S possibly damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nrxn2 A T 19: 6,448,278 S258C possibly damaging Het
Olfr1024 C T 2: 85,904,748 C102Y possibly damaging Het
Olfr1346 T A 7: 6,474,849 C246* probably null Het
Olfr672 G A 7: 104,996,104 H267Y probably benign Het
Olfr786 C T 10: 129,437,079 T89I probably benign Het
Olfr893 G T 9: 38,209,290 C79F probably benign Het
Osgin2 G A 4: 16,013,739 probably benign Het
Otud3 G A 4: 138,913,749 R27W probably damaging Het
Pcdhga12 T A 18: 37,768,237 F707L possibly damaging Het
Pik3r1 T C 13: 101,757,610 E17G probably damaging Het
Prickle4 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 17: 47,689,881 probably benign Het
Prokr1 G A 6: 87,588,696 R56W probably benign Het
Ptprz1 G A 6: 23,024,958 C1731Y probably damaging Het
Rbm15b A T 9: 106,885,829 F380Y possibly damaging Het
Rfc5 G A 5: 117,386,820 L56F probably damaging Het
Rhpn2 A T 7: 35,390,803 M617L probably benign Het
Rusc1 T C 3: 89,088,270 probably null Het
Sec23ip A G 7: 128,752,910 N297D probably damaging Het
Sema3c A T 5: 17,675,159 H259L probably benign Het
Sgsm1 G A 5: 113,280,462 probably benign Het
Sipa1l2 T A 8: 125,491,867 S244C probably damaging Het
Slc39a5 T C 10: 128,398,447 I196V probably benign Het
Smim22 G A 16: 5,007,858 A36T probably damaging Het
Spag6 A G 2: 18,742,777 I408V probably benign Het
Sult2a5 A G 7: 13,625,386 I96V probably benign Het
Tmcc2 C A 1: 132,380,779 A126S probably benign Het
Tsc2 A T 17: 24,600,035 S1276T probably damaging Het
Ttc21a A G 9: 119,959,037 S843G probably benign Het
Tubd1 G C 11: 86,552,795 V110L possibly damaging Het
Ugt1a2 T A 1: 88,200,812 V59D probably damaging Het
Vsig8 T A 1: 172,561,575 H131Q probably benign Het
Zbtb42 C A 12: 112,680,427 Y345* probably null Het
Zfp612 T A 8: 110,089,944 C594* probably null Het
Zfp940 A G 7: 29,845,399 V361A probably benign Het
Other mutations in Kansl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Kansl1 APN 11 104424466 missense probably damaging 0.96
IGL00658:Kansl1 APN 11 104357526 missense probably benign 0.10
IGL00688:Kansl1 APN 11 104425066 missense probably damaging 1.00
IGL01121:Kansl1 APN 11 104335596 missense probably benign 0.01
IGL01624:Kansl1 APN 11 104424552 missense probably benign 0.13
IGL02187:Kansl1 APN 11 104378831 splice site probably null
IGL02711:Kansl1 APN 11 104335575 missense probably damaging 1.00
IGL02965:Kansl1 APN 11 104335165 missense probably damaging 0.99
kansas UTSW 11 104424132 missense possibly damaging 0.94
wichita UTSW 11 104356767 missense possibly damaging 0.90
NA:Kansl1 UTSW 11 104342367 missense probably benign 0.09
R0399:Kansl1 UTSW 11 104424132 missense possibly damaging 0.94
R0611:Kansl1 UTSW 11 104338186 missense probably benign 0.31
R0665:Kansl1 UTSW 11 104343538 missense probably benign
R0667:Kansl1 UTSW 11 104343538 missense probably benign
R0747:Kansl1 UTSW 11 104342976 missense probably benign 0.00
R0865:Kansl1 UTSW 11 104424368 missense probably benign 0.08
R1479:Kansl1 UTSW 11 104342416 missense probably damaging 1.00
R1679:Kansl1 UTSW 11 104423996 missense probably damaging 1.00
R1818:Kansl1 UTSW 11 104342457 missense possibly damaging 0.80
R1922:Kansl1 UTSW 11 104343640 missense probably damaging 1.00
R1932:Kansl1 UTSW 11 104335097 missense probably damaging 0.99
R2105:Kansl1 UTSW 11 104335559 missense probably damaging 0.98
R2907:Kansl1 UTSW 11 104424460 missense possibly damaging 0.82
R3935:Kansl1 UTSW 11 104343543 missense possibly damaging 0.83
R3936:Kansl1 UTSW 11 104343543 missense possibly damaging 0.83
R4282:Kansl1 UTSW 11 104378689 missense probably benign 0.19
R4455:Kansl1 UTSW 11 104424358 missense possibly damaging 0.47
R4696:Kansl1 UTSW 11 104356767 missense possibly damaging 0.90
R4846:Kansl1 UTSW 11 104342972 missense possibly damaging 0.48
R4973:Kansl1 UTSW 11 104424321 missense probably damaging 1.00
R4975:Kansl1 UTSW 11 104335564 missense probably damaging 1.00
R5085:Kansl1 UTSW 11 104424342 missense probably damaging 1.00
R5227:Kansl1 UTSW 11 104356814 missense probably benign 0.19
R5310:Kansl1 UTSW 11 104424858 missense possibly damaging 0.95
R5652:Kansl1 UTSW 11 104338166 missense probably damaging 1.00
R5677:Kansl1 UTSW 11 104335148 missense probably benign 0.00
R5980:Kansl1 UTSW 11 104343637 missense possibly damaging 0.96
R6013:Kansl1 UTSW 11 104350639 missense probably benign 0.00
R6253:Kansl1 UTSW 11 104357526 missense probably benign 0.10
R7751:Kansl1 UTSW 11 104424064 missense probably benign 0.30
R7880:Kansl1 UTSW 11 104424153 missense probably damaging 1.00
R7888:Kansl1 UTSW 11 104342422 missense probably benign 0.00
R7963:Kansl1 UTSW 11 104424153 missense probably damaging 1.00
R7971:Kansl1 UTSW 11 104342422 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACCAATGCAGGTAGAGGTGC -3'
(R):5'- GGTTGACTTCTGAAGCCTAGTG -3'

Sequencing Primer
(F):5'- TCACTTCTCTCAGATGAATGATCTCG -3'
(R):5'- ACTTCTGAAGCCTAGTGTTAGC -3'
Posted On2016-03-17