Incidental Mutation 'R4890:Adcy4'
ID 377283
Institutional Source Beutler Lab
Gene Symbol Adcy4
Ensembl Gene ENSMUSG00000022220
Gene Name adenylate cyclase 4
Synonyms
MMRRC Submission 042495-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4890 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 56006514-56021552 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 56016486 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 322 (D322N)
Ref Sequence ENSEMBL: ENSMUSP00000130530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002398] [ENSMUST00000170223] [ENSMUST00000227031]
AlphaFold Q91WF3
Predicted Effect probably damaging
Transcript: ENSMUST00000002398
AA Change: D322N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002398
Gene: ENSMUSG00000022220
AA Change: D322N

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
low complexity region 66 80 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 2.4e-35 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170223
AA Change: D322N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130530
Gene: ENSMUSG00000022220
AA Change: D322N

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 61 80 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 119 138 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 172 194 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 1.6e-24 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226361
Predicted Effect probably benign
Transcript: ENSMUST00000227031
Meta Mutation Damage Score 0.7907 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). Mouse studies show that adenylate cyclase 4, along with adenylate cyclases 2 and 3, is expressed in olfactory cilia, suggesting that several different adenylate cyclases may couple to olfactory receptors and that there may be multiple receptor-mediated mechanisms for the generation of cAMP signals. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T C 1: 130,668,725 (GRCm39) probably benign Het
Adgrb3 T C 1: 25,260,908 (GRCm39) N916S probably damaging Het
Aox1 T C 1: 58,373,862 (GRCm39) V841A probably benign Het
Baz2b A T 2: 59,756,383 (GRCm39) M983K probably damaging Het
C2cd2l A G 9: 44,222,430 (GRCm39) F682L probably damaging Het
Ccsap T G 8: 124,572,160 (GRCm39) E114A possibly damaging Het
Cept1 T A 3: 106,413,123 (GRCm39) T201S probably damaging Het
Cfap221 T C 1: 119,883,476 (GRCm39) M232V probably benign Het
Chsy1 A G 7: 65,759,974 (GRCm39) R106G probably benign Het
Cit C T 5: 116,126,182 (GRCm39) probably benign Het
Cldn7 G A 11: 69,857,918 (GRCm39) V42I probably benign Het
Cnnm4 T A 1: 36,511,345 (GRCm39) V191E probably benign Het
Cntf A T 19: 12,741,326 (GRCm39) V178D possibly damaging Het
Ctsz C A 2: 174,270,393 (GRCm39) R263L probably damaging Het
Dclk1 T C 3: 55,429,353 (GRCm39) M407T probably benign Het
Dennd1a A T 2: 38,066,238 (GRCm39) probably benign Het
Dnhd1 A G 7: 105,306,164 (GRCm39) I368V possibly damaging Het
Gak A T 5: 108,728,742 (GRCm39) probably benign Het
Hepacam2 A T 6: 3,487,231 (GRCm39) V42D probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,366,470 (GRCm39) probably benign Het
Insr T A 8: 3,248,234 (GRCm39) Q437L probably benign Het
Itga8 G A 2: 12,198,102 (GRCm39) probably benign Het
Kansl1 A T 11: 104,233,868 (GRCm39) C732S probably benign Het
Kdsr T C 1: 106,680,964 (GRCm39) K78R probably benign Het
Kif14 T C 1: 136,414,868 (GRCm39) S785P possibly damaging Het
Lbr C A 1: 181,645,133 (GRCm39) L506F probably benign Het
Macf1 C A 4: 123,342,031 (GRCm39) C2720F probably damaging Het
Mapt G A 11: 104,218,975 (GRCm39) D738N probably damaging Het
Mroh9 T C 1: 162,854,093 (GRCm39) Y769C probably damaging Het
Mylk2 A G 2: 152,762,274 (GRCm39) N515S possibly damaging Het
Myorg G A 4: 41,498,877 (GRCm39) T251M probably benign Het
Nek10 T A 14: 14,860,986 (GRCm38) L513M possibly damaging Het
Nrxn2 A T 19: 6,498,308 (GRCm39) S258C possibly damaging Het
Nudt16l2 A T 9: 105,021,786 (GRCm39) S87T possibly damaging Het
Or52e15 G A 7: 104,645,311 (GRCm39) H267Y probably benign Het
Or5m12 C T 2: 85,735,092 (GRCm39) C102Y possibly damaging Het
Or6c1b C T 10: 129,272,948 (GRCm39) T89I probably benign Het
Or6z5 T A 7: 6,477,848 (GRCm39) C246* probably null Het
Or8c15 G T 9: 38,120,586 (GRCm39) C79F probably benign Het
Osgin2 G A 4: 16,013,739 (GRCm39) probably benign Het
Otud3 G A 4: 138,641,060 (GRCm39) R27W probably damaging Het
Pcare C T 17: 72,059,306 (GRCm39) V124I possibly damaging Het
Pcdhga12 T A 18: 37,901,290 (GRCm39) F707L possibly damaging Het
Pik3r1 T C 13: 101,894,118 (GRCm39) E17G probably damaging Het
Pramel19 A G 4: 101,798,788 (GRCm39) E253G probably damaging Het
Prickle4 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 17: 48,000,806 (GRCm39) probably benign Het
Prokr1 G A 6: 87,565,678 (GRCm39) R56W probably benign Het
Ptprz1 G A 6: 23,024,957 (GRCm39) C1731Y probably damaging Het
Rbm15b A T 9: 106,763,028 (GRCm39) F380Y possibly damaging Het
Rfc5 G A 5: 117,524,885 (GRCm39) L56F probably damaging Het
Rhpn2 A T 7: 35,090,228 (GRCm39) M617L probably benign Het
Rusc1 T C 3: 88,995,577 (GRCm39) probably null Het
Sec23ip A G 7: 128,354,634 (GRCm39) N297D probably damaging Het
Sema3c A T 5: 17,880,157 (GRCm39) H259L probably benign Het
Sgsm1 G A 5: 113,428,328 (GRCm39) probably benign Het
Shisal2a A G 4: 108,224,998 (GRCm39) V188A probably benign Het
Sipa1l2 T A 8: 126,218,606 (GRCm39) S244C probably damaging Het
Slc39a5 T C 10: 128,234,316 (GRCm39) I196V probably benign Het
Smim22 G A 16: 4,825,722 (GRCm39) A36T probably damaging Het
Spag6 A G 2: 18,747,588 (GRCm39) I408V probably benign Het
Sult2a5 A G 7: 13,359,311 (GRCm39) I96V probably benign Het
Tmcc2 C A 1: 132,308,517 (GRCm39) A126S probably benign Het
Tsc2 A T 17: 24,819,009 (GRCm39) S1276T probably damaging Het
Ttc21a A G 9: 119,788,103 (GRCm39) S843G probably benign Het
Tubd1 G C 11: 86,443,621 (GRCm39) V110L possibly damaging Het
Ugt1a2 T A 1: 88,128,534 (GRCm39) V59D probably damaging Het
Vmn2r-ps158 A G 7: 42,697,024 (GRCm39) R687G probably damaging Het
Vsig8 T A 1: 172,389,142 (GRCm39) H131Q probably benign Het
Zbtb42 C A 12: 112,646,861 (GRCm39) Y345* probably null Het
Zfp612 T A 8: 110,816,576 (GRCm39) C594* probably null Het
Zfp940 A G 7: 29,544,824 (GRCm39) V361A probably benign Het
Other mutations in Adcy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Adcy4 APN 14 56,011,120 (GRCm39) splice site probably null
IGL02406:Adcy4 APN 14 56,007,504 (GRCm39) missense possibly damaging 0.45
IGL02503:Adcy4 APN 14 56,008,962 (GRCm39) missense probably damaging 1.00
IGL02543:Adcy4 APN 14 56,006,627 (GRCm39) missense probably benign
IGL02616:Adcy4 APN 14 56,020,971 (GRCm39) splice site probably null
IGL03002:Adcy4 APN 14 56,011,013 (GRCm39) missense probably benign 0.31
IGL03026:Adcy4 APN 14 56,015,467 (GRCm39) missense probably damaging 1.00
IGL03190:Adcy4 APN 14 56,016,510 (GRCm39) missense probably damaging 1.00
IGL03247:Adcy4 APN 14 56,007,553 (GRCm39) missense probably damaging 1.00
stressed UTSW 14 56,016,556 (GRCm39) splice site probably null
IGL03098:Adcy4 UTSW 14 56,019,038 (GRCm39) missense probably null 0.82
R0098:Adcy4 UTSW 14 56,007,284 (GRCm39) missense possibly damaging 0.78
R0102:Adcy4 UTSW 14 56,008,990 (GRCm39) missense probably benign 0.29
R0396:Adcy4 UTSW 14 56,009,745 (GRCm39) missense probably benign 0.00
R0482:Adcy4 UTSW 14 56,012,029 (GRCm39) critical splice acceptor site probably null
R0634:Adcy4 UTSW 14 56,019,054 (GRCm39) missense probably benign
R0691:Adcy4 UTSW 14 56,010,104 (GRCm39) splice site probably benign
R0704:Adcy4 UTSW 14 56,010,213 (GRCm39) missense probably benign
R0815:Adcy4 UTSW 14 56,021,056 (GRCm39) missense probably damaging 1.00
R0863:Adcy4 UTSW 14 56,021,056 (GRCm39) missense probably damaging 1.00
R1446:Adcy4 UTSW 14 56,007,480 (GRCm39) critical splice donor site probably null
R1462:Adcy4 UTSW 14 56,015,765 (GRCm39) missense possibly damaging 0.78
R1462:Adcy4 UTSW 14 56,015,765 (GRCm39) missense possibly damaging 0.78
R1463:Adcy4 UTSW 14 56,016,396 (GRCm39) missense probably damaging 1.00
R1624:Adcy4 UTSW 14 56,019,384 (GRCm39) missense possibly damaging 0.68
R1799:Adcy4 UTSW 14 56,008,929 (GRCm39) missense probably benign 0.01
R1878:Adcy4 UTSW 14 56,007,362 (GRCm39) missense probably damaging 0.96
R2007:Adcy4 UTSW 14 56,015,770 (GRCm39) missense possibly damaging 0.45
R2156:Adcy4 UTSW 14 56,006,627 (GRCm39) missense probably benign 0.09
R2425:Adcy4 UTSW 14 56,015,474 (GRCm39) missense probably damaging 0.99
R2517:Adcy4 UTSW 14 56,019,403 (GRCm39) missense probably damaging 1.00
R3882:Adcy4 UTSW 14 56,012,003 (GRCm39) missense probably benign 0.27
R4021:Adcy4 UTSW 14 56,012,635 (GRCm39) splice site probably null
R4022:Adcy4 UTSW 14 56,012,635 (GRCm39) splice site probably null
R4411:Adcy4 UTSW 14 56,006,900 (GRCm39) missense probably damaging 1.00
R4530:Adcy4 UTSW 14 56,016,485 (GRCm39) missense probably damaging 1.00
R4560:Adcy4 UTSW 14 56,016,407 (GRCm39) splice site probably null
R4704:Adcy4 UTSW 14 56,012,482 (GRCm39) missense possibly damaging 0.91
R4780:Adcy4 UTSW 14 56,012,493 (GRCm39) missense probably benign 0.07
R4860:Adcy4 UTSW 14 56,019,384 (GRCm39) missense possibly damaging 0.68
R4860:Adcy4 UTSW 14 56,019,384 (GRCm39) missense possibly damaging 0.68
R4868:Adcy4 UTSW 14 56,011,179 (GRCm39) missense probably benign
R4920:Adcy4 UTSW 14 56,016,486 (GRCm39) missense probably damaging 1.00
R4948:Adcy4 UTSW 14 56,016,486 (GRCm39) missense probably damaging 1.00
R4952:Adcy4 UTSW 14 56,016,486 (GRCm39) missense probably damaging 1.00
R4953:Adcy4 UTSW 14 56,016,486 (GRCm39) missense probably damaging 1.00
R4987:Adcy4 UTSW 14 56,010,934 (GRCm39) missense probably benign 0.01
R4991:Adcy4 UTSW 14 56,010,922 (GRCm39) missense probably benign 0.03
R5080:Adcy4 UTSW 14 56,009,832 (GRCm39) missense probably damaging 0.98
R5620:Adcy4 UTSW 14 56,009,824 (GRCm39) nonsense probably null
R5652:Adcy4 UTSW 14 56,010,900 (GRCm39) missense probably benign
R5726:Adcy4 UTSW 14 56,021,118 (GRCm39) missense probably damaging 1.00
R5910:Adcy4 UTSW 14 56,016,470 (GRCm39) missense probably damaging 1.00
R5958:Adcy4 UTSW 14 56,016,556 (GRCm39) splice site probably null
R6280:Adcy4 UTSW 14 56,016,500 (GRCm39) missense probably damaging 1.00
R6318:Adcy4 UTSW 14 56,006,681 (GRCm39) missense probably damaging 1.00
R6598:Adcy4 UTSW 14 56,007,502 (GRCm39) missense probably benign 0.03
R6947:Adcy4 UTSW 14 56,015,848 (GRCm39) missense possibly damaging 0.92
R7012:Adcy4 UTSW 14 56,017,376 (GRCm39) missense possibly damaging 0.95
R7147:Adcy4 UTSW 14 56,017,182 (GRCm39) missense probably damaging 1.00
R7386:Adcy4 UTSW 14 56,015,784 (GRCm39) missense probably damaging 1.00
R7414:Adcy4 UTSW 14 56,019,090 (GRCm39) missense probably benign 0.15
R7431:Adcy4 UTSW 14 56,010,129 (GRCm39) missense probably benign 0.01
R7490:Adcy4 UTSW 14 56,007,890 (GRCm39) missense possibly damaging 0.66
R7552:Adcy4 UTSW 14 56,010,922 (GRCm39) missense probably benign 0.00
R7672:Adcy4 UTSW 14 56,018,362 (GRCm39) missense probably benign 0.14
R8003:Adcy4 UTSW 14 56,019,092 (GRCm39) missense probably benign 0.00
R8042:Adcy4 UTSW 14 56,012,696 (GRCm39) missense probably benign 0.01
R8100:Adcy4 UTSW 14 56,009,722 (GRCm39) nonsense probably null
R8343:Adcy4 UTSW 14 56,012,697 (GRCm39) missense probably benign 0.02
R8801:Adcy4 UTSW 14 56,009,452 (GRCm39) missense probably benign 0.05
R8811:Adcy4 UTSW 14 56,010,221 (GRCm39) missense probably benign
R8993:Adcy4 UTSW 14 56,016,156 (GRCm39) missense probably damaging 1.00
R8993:Adcy4 UTSW 14 56,008,835 (GRCm39) missense probably null 1.00
R9026:Adcy4 UTSW 14 56,016,426 (GRCm39) missense probably damaging 1.00
X0025:Adcy4 UTSW 14 56,007,848 (GRCm39) missense probably damaging 1.00
Z1088:Adcy4 UTSW 14 56,018,413 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGTGTGGGACAAGCTTAGTG -3'
(R):5'- CAAGGGACGCCATAGATCTGAC -3'

Sequencing Primer
(F):5'- TCTTCTCCAGGAGGACTGC -3'
(R):5'- GCCATAGATCTGACCTAGACATTC -3'
Posted On 2016-03-17