Incidental Mutation 'R4890:Nrxn2'
ID377290
Institutional Source Beutler Lab
Gene Symbol Nrxn2
Ensembl Gene ENSMUSG00000033768
Gene Nameneurexin II
Synonyms6430591O13Rik, neurexin II beta, neurexin II alpha
MMRRC Submission 042495-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4890 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6418731-6544169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6448278 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 258 (S258C)
Ref Sequence ENSEMBL: ENSMUSP00000119762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077182] [ENSMUST00000113461] [ENSMUST00000113462] [ENSMUST00000137166] [ENSMUST00000137821]
Predicted Effect probably benign
Transcript: ENSMUST00000077182
AA Change: S258C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000076424
Gene: ENSMUSG00000033768
AA Change: S258C

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 444 1.18e-33 SMART
LamG 498 651 1.51e-40 SMART
EGF 678 712 8.91e-3 SMART
LamG 737 875 4.91e-22 SMART
LamG 923 1059 1.08e-41 SMART
EGF 1084 1118 1.91e1 SMART
LamG 1146 1303 4.48e-16 SMART
low complexity region 1332 1362 N/A INTRINSIC
low complexity region 1430 1445 N/A INTRINSIC
4.1m 1448 1466 3.75e-4 SMART
low complexity region 1480 1499 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113461
AA Change: S258C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109088
Gene: ENSMUSG00000033768
AA Change: S258C

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
LamG 286 428 8.4e-30 SMART
LamG 482 635 1.51e-40 SMART
EGF 662 696 8.91e-3 SMART
LamG 721 850 2.36e-24 SMART
LamG 898 1034 1.08e-41 SMART
EGF 1059 1093 1.91e1 SMART
LamG 1121 1248 1.26e-19 SMART
low complexity region 1277 1307 N/A INTRINSIC
low complexity region 1363 1384 N/A INTRINSIC
low complexity region 1567 1582 N/A INTRINSIC
4.1m 1585 1603 3.75e-4 SMART
low complexity region 1617 1636 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113462
AA Change: S258C

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000109089
Gene: ENSMUSG00000033768
AA Change: S258C

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 452 8.4e-30 SMART
LamG 506 659 1.51e-40 SMART
EGF 686 720 8.91e-3 SMART
LamG 745 883 4.91e-22 SMART
LamG 931 1067 1.08e-41 SMART
EGF 1092 1126 1.91e1 SMART
LamG 1154 1311 4.48e-16 SMART
low complexity region 1340 1370 N/A INTRINSIC
low complexity region 1426 1447 N/A INTRINSIC
low complexity region 1630 1645 N/A INTRINSIC
4.1m 1648 1666 3.75e-4 SMART
low complexity region 1680 1699 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128272
Predicted Effect possibly damaging
Transcript: ENSMUST00000137166
AA Change: S258C

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119762
Gene: ENSMUSG00000033768
AA Change: S258C

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 459 8.87e-29 SMART
LamG 513 666 1.51e-40 SMART
EGF 693 727 8.91e-3 SMART
LamG 752 890 4.91e-22 SMART
LamG 938 1074 1.08e-41 SMART
EGF 1099 1133 1.91e1 SMART
LamG 1161 1318 4.48e-16 SMART
low complexity region 1347 1377 N/A INTRINSIC
low complexity region 1433 1454 N/A INTRINSIC
low complexity region 1637 1652 N/A INTRINSIC
4.1m 1655 1673 3.75e-4 SMART
low complexity region 1687 1706 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137821
SMART Domains Protein: ENSMUSP00000122920
Gene: ENSMUSG00000033768

DomainStartEndE-ValueType
EGF 6 43 1.73e1 SMART
low complexity region 59 67 N/A INTRINSIC
LamG 101 212 1.63e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000155158
AA Change: S18C
SMART Domains Protein: ENSMUSP00000118878
Gene: ENSMUSG00000033768
AA Change: S18C

DomainStartEndE-ValueType
Blast:LamG 2 45 8e-7 BLAST
LamG 71 205 1.18e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157014
Meta Mutation Damage Score 0.0693 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin gene family. The products of these genes function as cell adhesion molecules and receptors in the vertebrate nervous system. These genes utilize two promoters. The majority of transcripts are produced from the upstream promoter and encode alpha-neurexin isoforms while a smaller number of transcripts are produced from the downstream promoter and encode beta-neuresin isoforms. The alpha-neurexins contain epidermal growth factor-like (EGF-like) sequences and laminin G domains, and have been shown to interact with neurexophilins. The beta-neurexins lack EGF-like sequences and contain fewer laminin G domains than alpha-neurexins. Alternative splicing and the use of alternative promoters may generate thousands of transcript variants (PMID: 12036300, PMID: 11944992).[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are generally non-viable; surviving homozygotes show a 30-40% decrease in body weight and their inhibitory postsynaptic currents (IPSCs) are decreased in cortical slice cultures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,587 S87T possibly damaging Het
AA986860 T C 1: 130,740,988 probably benign Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Adgrb3 T C 1: 25,221,827 N916S probably damaging Het
AI464131 G A 4: 41,498,877 T251M probably benign Het
Aox2 T C 1: 58,334,703 V841A probably benign Het
Baz2b A T 2: 59,926,039 M983K probably damaging Het
BC027072 C T 17: 71,752,311 V124I possibly damaging Het
C2cd2l A G 9: 44,311,133 F682L probably damaging Het
Ccsap T G 8: 123,845,421 E114A possibly damaging Het
Cept1 T A 3: 106,505,807 T201S probably damaging Het
Cfap221 T C 1: 119,955,746 M232V probably benign Het
Chsy1 A G 7: 66,110,226 R106G probably benign Het
Cit C T 5: 115,988,123 probably benign Het
Cldn7 G A 11: 69,967,092 V42I probably benign Het
Cnnm4 T A 1: 36,472,264 V191E probably benign Het
Cntf A T 19: 12,763,962 V178D possibly damaging Het
Ctsz C A 2: 174,428,600 R263L probably damaging Het
Dclk1 T C 3: 55,521,932 M407T probably benign Het
Dennd1a A T 2: 38,176,226 probably benign Het
Dnhd1 A G 7: 105,656,957 I368V possibly damaging Het
Fam159a A G 4: 108,367,801 V188A probably benign Het
Gak A T 5: 108,580,876 probably benign Het
Gm12794 A G 4: 101,941,591 E253G probably damaging Het
Gm9268 A G 7: 43,047,600 R687G probably damaging Het
Hepacam2 A T 6: 3,487,231 V42D probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Insr T A 8: 3,198,234 Q437L probably benign Het
Itga8 G A 2: 12,193,291 probably benign Het
Kansl1 A T 11: 104,343,042 C732S probably benign Het
Kdsr T C 1: 106,753,234 K78R probably benign Het
Kif14 T C 1: 136,487,130 S785P possibly damaging Het
Lbr C A 1: 181,817,568 L506F probably benign Het
Macf1 C A 4: 123,448,238 C2720F probably damaging Het
Mapt G A 11: 104,328,149 D738N probably damaging Het
Mroh9 T C 1: 163,026,524 Y769C probably damaging Het
Mylk2 A G 2: 152,920,354 N515S possibly damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Olfr1024 C T 2: 85,904,748 C102Y possibly damaging Het
Olfr1346 T A 7: 6,474,849 C246* probably null Het
Olfr672 G A 7: 104,996,104 H267Y probably benign Het
Olfr786 C T 10: 129,437,079 T89I probably benign Het
Olfr893 G T 9: 38,209,290 C79F probably benign Het
Osgin2 G A 4: 16,013,739 probably benign Het
Otud3 G A 4: 138,913,749 R27W probably damaging Het
Pcdhga12 T A 18: 37,768,237 F707L possibly damaging Het
Pik3r1 T C 13: 101,757,610 E17G probably damaging Het
Prickle4 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 17: 47,689,881 probably benign Het
Prokr1 G A 6: 87,588,696 R56W probably benign Het
Ptprz1 G A 6: 23,024,958 C1731Y probably damaging Het
Rbm15b A T 9: 106,885,829 F380Y possibly damaging Het
Rfc5 G A 5: 117,386,820 L56F probably damaging Het
Rhpn2 A T 7: 35,390,803 M617L probably benign Het
Rusc1 T C 3: 89,088,270 probably null Het
Sec23ip A G 7: 128,752,910 N297D probably damaging Het
Sema3c A T 5: 17,675,159 H259L probably benign Het
Sgsm1 G A 5: 113,280,462 probably benign Het
Sipa1l2 T A 8: 125,491,867 S244C probably damaging Het
Slc39a5 T C 10: 128,398,447 I196V probably benign Het
Smim22 G A 16: 5,007,858 A36T probably damaging Het
Spag6 A G 2: 18,742,777 I408V probably benign Het
Sult2a5 A G 7: 13,625,386 I96V probably benign Het
Tmcc2 C A 1: 132,380,779 A126S probably benign Het
Tsc2 A T 17: 24,600,035 S1276T probably damaging Het
Ttc21a A G 9: 119,959,037 S843G probably benign Het
Tubd1 G C 11: 86,552,795 V110L possibly damaging Het
Ugt1a2 T A 1: 88,200,812 V59D probably damaging Het
Vsig8 T A 1: 172,561,575 H131Q probably benign Het
Zbtb42 C A 12: 112,680,427 Y345* probably null Het
Zfp612 T A 8: 110,089,944 C594* probably null Het
Zfp940 A G 7: 29,845,399 V361A probably benign Het
Other mutations in Nrxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Nrxn2 APN 19 6473593 missense possibly damaging 0.84
IGL01020:Nrxn2 APN 19 6493443 missense probably benign 0.02
IGL01064:Nrxn2 APN 19 6517053 missense probably damaging 0.97
IGL01561:Nrxn2 APN 19 6490142 missense probably damaging 1.00
IGL01759:Nrxn2 APN 19 6509929 missense probably damaging 1.00
IGL02071:Nrxn2 APN 19 6481753 missense probably damaging 1.00
IGL02085:Nrxn2 APN 19 6492868 missense possibly damaging 0.83
IGL02132:Nrxn2 APN 19 6472276 missense probably damaging 1.00
IGL02476:Nrxn2 APN 19 6454985 missense probably damaging 1.00
IGL02605:Nrxn2 APN 19 6450580 missense probably benign 0.02
IGL03123:Nrxn2 APN 19 6481737 missense probably damaging 0.98
IGL03288:Nrxn2 APN 19 6490696 missense probably damaging 1.00
PIT4687001:Nrxn2 UTSW 19 6481308 missense probably benign 0.06
R0019:Nrxn2 UTSW 19 6509957 splice site probably benign
R0257:Nrxn2 UTSW 19 6490698 missense possibly damaging 0.81
R0305:Nrxn2 UTSW 19 6519283 missense probably damaging 1.00
R0453:Nrxn2 UTSW 19 6491521 missense probably damaging 1.00
R0512:Nrxn2 UTSW 19 6517198 missense probably damaging 1.00
R0539:Nrxn2 UTSW 19 6493404 missense probably damaging 0.99
R0571:Nrxn2 UTSW 19 6473533 missense probably damaging 1.00
R1373:Nrxn2 UTSW 19 6472301 missense probably damaging 1.00
R1434:Nrxn2 UTSW 19 6443612 intron probably null
R1454:Nrxn2 UTSW 19 6481446 missense probably damaging 0.98
R1671:Nrxn2 UTSW 19 6473750 missense probably damaging 1.00
R1692:Nrxn2 UTSW 19 6519268 missense probably damaging 1.00
R1858:Nrxn2 UTSW 19 6488795 missense probably benign 0.01
R1859:Nrxn2 UTSW 19 6488795 missense probably benign 0.01
R2153:Nrxn2 UTSW 19 6504914 missense probably damaging 1.00
R2196:Nrxn2 UTSW 19 6490109 missense probably damaging 1.00
R2209:Nrxn2 UTSW 19 6493007 missense probably benign 0.01
R2278:Nrxn2 UTSW 19 6481853 missense probably damaging 1.00
R2441:Nrxn2 UTSW 19 6428301 missense probably damaging 1.00
R3897:Nrxn2 UTSW 19 6519257 missense probably damaging 1.00
R3943:Nrxn2 UTSW 19 6473335 missense probably damaging 1.00
R4091:Nrxn2 UTSW 19 6473414 missense probably damaging 1.00
R4162:Nrxn2 UTSW 19 6532143 missense probably damaging 1.00
R4164:Nrxn2 UTSW 19 6532143 missense probably damaging 1.00
R4495:Nrxn2 UTSW 19 6531399 missense probably benign 0.05
R4599:Nrxn2 UTSW 19 6455252 missense probably damaging 0.98
R4735:Nrxn2 UTSW 19 6498454 missense possibly damaging 0.86
R4757:Nrxn2 UTSW 19 6509821 missense probably damaging 1.00
R5052:Nrxn2 UTSW 19 6455204 missense probably damaging 1.00
R5311:Nrxn2 UTSW 19 6531398 missense probably benign 0.05
R5330:Nrxn2 UTSW 19 6490081 missense probably damaging 0.96
R5331:Nrxn2 UTSW 19 6490081 missense probably damaging 0.96
R5530:Nrxn2 UTSW 19 6498367 missense possibly damaging 0.93
R5556:Nrxn2 UTSW 19 6490091 missense probably damaging 1.00
R5763:Nrxn2 UTSW 19 6531339 missense probably benign 0.15
R5829:Nrxn2 UTSW 19 6490849 missense probably benign 0.03
R5988:Nrxn2 UTSW 19 6492871 missense possibly damaging 0.83
R6003:Nrxn2 UTSW 19 6498328 missense possibly damaging 0.93
R6032:Nrxn2 UTSW 19 6517132 missense probably damaging 1.00
R6032:Nrxn2 UTSW 19 6517132 missense probably damaging 1.00
R6288:Nrxn2 UTSW 19 6490561 missense probably damaging 1.00
R6334:Nrxn2 UTSW 19 6531292 unclassified probably null
R6373:Nrxn2 UTSW 19 6509830 missense probably damaging 1.00
R6397:Nrxn2 UTSW 19 6532122 missense probably damaging 1.00
R6669:Nrxn2 UTSW 19 6481191 missense probably damaging 1.00
R6980:Nrxn2 UTSW 19 6450579 missense probably benign 0.04
R6985:Nrxn2 UTSW 19 6481245 missense probably damaging 1.00
R7184:Nrxn2 UTSW 19 6490552 missense probably damaging 1.00
R7361:Nrxn2 UTSW 19 6517082 missense probably benign 0.00
R7576:Nrxn2 UTSW 19 6531510 nonsense probably null
R7604:Nrxn2 UTSW 19 6531961 missense probably damaging 1.00
R7631:Nrxn2 UTSW 19 6481795 missense possibly damaging 0.83
R7768:Nrxn2 UTSW 19 6481379 missense possibly damaging 0.69
R7805:Nrxn2 UTSW 19 6531706 missense probably benign
R7896:Nrxn2 UTSW 19 6532053 missense possibly damaging 0.89
R7979:Nrxn2 UTSW 19 6532053 missense possibly damaging 0.89
R7998:Nrxn2 UTSW 19 6509875 missense probably damaging 0.98
X0022:Nrxn2 UTSW 19 6509917 missense probably damaging 1.00
Z1177:Nrxn2 UTSW 19 6498517 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCTGTCACAAGTTAACAGGG -3'
(R):5'- GCAGGAGAGTGTACATCTGACATC -3'

Sequencing Primer
(F):5'- AACAGGGTTTTAAATTGTGGCAGC -3'
(R):5'- CTGACATCAGAAACCAAGGTGACG -3'
Posted On2016-03-17