Incidental Mutation 'R4891:Ptprn2'
ID377319
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Nameprotein tyrosine phosphatase, receptor type, N polypeptide 2
Synonymsphogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta
MMRRC Submission 042496-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R4891 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location116485720-117276849 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 117233365 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000064046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
Predicted Effect probably null
Transcript: ENSMUST00000070733
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190132
Predicted Effect probably benign
Transcript: ENSMUST00000190247
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 59,033,000 Y1088C probably damaging Het
Cercam C A 2: 29,869,271 probably benign Het
Chst1 A G 2: 92,613,992 T270A possibly damaging Het
Cluh C T 11: 74,665,059 T816I possibly damaging Het
Edn3 A G 2: 174,761,732 H91R probably benign Het
Fam135a A G 1: 24,030,328 S487P probably benign Het
Galns T A 8: 122,599,156 D212V possibly damaging Het
Grin2a A G 16: 9,657,706 V582A possibly damaging Het
Hs3st4 T A 7: 124,396,829 N239K possibly damaging Het
Kmt2b C T 7: 30,576,761 W1062* probably null Het
Lrp1 T C 10: 127,541,752 N4110S probably damaging Het
Mag T C 7: 30,900,368 H582R probably benign Het
Maml3 C T 3: 51,694,510 probably benign Het
Ndufa5 A G 6: 24,519,247 V26A possibly damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Olfr206 T A 16: 59,345,471 T77S possibly damaging Het
Olfr577 T A 7: 102,973,552 I147L probably benign Het
Olfr71 C T 4: 43,706,194 A125T probably damaging Het
Plxdc2 A G 2: 16,712,146 H347R probably benign Het
Rab3gap2 C T 1: 185,259,366 A683V probably benign Het
Rnf157 A G 11: 116,358,670 V240A probably damaging Het
Slc10a5 A T 3: 10,334,625 V325E possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Sptbn2 C T 19: 4,738,469 R1159C probably damaging Het
Stk36 A G 1: 74,603,256 D14G probably damaging Het
Thap2 T C 10: 115,372,696 K173R probably damaging Het
Themis2 G T 4: 132,783,357 Q625K probably benign Het
Vcpip1 G T 1: 9,748,062 P32Q unknown Het
Vmn1r229 A T 17: 20,814,819 T109S probably damaging Het
Vps13b T A 15: 35,640,515 probably null Het
Wdr64 A G 1: 175,698,779 probably benign Het
Wiz A G 17: 32,357,628 S642P possibly damaging Het
Zdhhc1 C T 8: 105,473,017 R383Q probably benign Het
Zfp462 T C 4: 55,060,055 S1194P probably damaging Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116841388 missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116900987 missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116873697 splice site probably benign
IGL02339:Ptprn2 APN 12 116722104 missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116888898 missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117211943 missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116876344 nonsense probably null
BB001:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117248688 missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117211846 splice site probably benign
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117211846 splice site probably benign
R0694:Ptprn2 UTSW 12 116824355 missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116722130 nonsense probably null
R0746:Ptprn2 UTSW 12 116901017 missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117212008 splice site probably null
R1443:Ptprn2 UTSW 12 117253615 missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117184722 missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117161709 missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116722172 missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116580428 missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117247717 missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116722133 missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116888877 missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116901008 missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116876000 missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116872094 missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116824396 missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117247773 nonsense probably null
R4872:Ptprn2 UTSW 12 117161694 missense probably damaging 1.00
R4970:Ptprn2 UTSW 12 117276595 missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116858928 missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117211862 missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117184647 missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116859119 missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117269589 missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116872038 missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117227200 missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116888888 missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116872056 missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117227225 splice site probably null
R7237:Ptprn2 UTSW 12 117161727 missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117248544 missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116858951 missense probably benign
R7460:Ptprn2 UTSW 12 117248681 missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116485866 start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116722119 missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116841320 missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117184737 missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117255548 missense possibly damaging 0.73
X0066:Ptprn2 UTSW 12 117161760 missense probably damaging 1.00
X0066:Ptprn2 UTSW 12 117184740 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CCGTATGTTAGTAGCCATGGG -3'
(R):5'- GATAAACTGTATTTGGGGCGC -3'

Sequencing Primer
(F):5'- TAGCCATGGGTACAAGCTGTGC -3'
(R):5'- AAACTGTATTTGGGGCGCATTTTTC -3'
Posted On2016-03-17