Incidental Mutation 'R4891:Ptprn2'
ID 377319
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Name protein tyrosine phosphatase receptor type N polypeptide 2
Synonyms IA-2 beta, PTP-NP, 4930425H11Rik, IA-2beta, phogrin
MMRRC Submission 042496-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.162) question?
Stock # R4891 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 116449340-117240469 bp(+) (GRCm39)
Type of Mutation splice site (4 bp from exon)
DNA Base Change (assembly) A to G at 117196985 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000064046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
AlphaFold P80560
Predicted Effect probably null
Transcript: ENSMUST00000070733
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190132
Predicted Effect probably benign
Transcript: ENSMUST00000190247
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 59,166,072 (GRCm39) Y1088C probably damaging Het
Cercam C A 2: 29,759,283 (GRCm39) probably benign Het
Chst1 A G 2: 92,444,337 (GRCm39) T270A possibly damaging Het
Cluh C T 11: 74,555,885 (GRCm39) T816I possibly damaging Het
Edn3 A G 2: 174,603,525 (GRCm39) H91R probably benign Het
Fam135a A G 1: 24,069,409 (GRCm39) S487P probably benign Het
Galns T A 8: 123,325,895 (GRCm39) D212V possibly damaging Het
Grin2a A G 16: 9,475,570 (GRCm39) V582A possibly damaging Het
Hs3st4 T A 7: 123,996,052 (GRCm39) N239K possibly damaging Het
Kmt2b C T 7: 30,276,186 (GRCm39) W1062* probably null Het
Lrp1 T C 10: 127,377,621 (GRCm39) N4110S probably damaging Het
Mag T C 7: 30,599,793 (GRCm39) H582R possibly damaging Het
Maml3 C T 3: 51,601,931 (GRCm39) probably benign Het
Ndufa5 A G 6: 24,519,246 (GRCm39) V26A possibly damaging Het
Nek10 T A 14: 14,860,986 (GRCm38) L513M possibly damaging Het
Or13j1 C T 4: 43,706,194 (GRCm39) A125T probably damaging Het
Or51g2 T A 7: 102,622,759 (GRCm39) I147L probably benign Het
Or5ac24 T A 16: 59,165,834 (GRCm39) T77S possibly damaging Het
Plxdc2 A G 2: 16,716,957 (GRCm39) H347R probably benign Het
Rab3gap2 C T 1: 184,991,563 (GRCm39) A683V probably benign Het
Rnf157 A G 11: 116,249,496 (GRCm39) V240A probably damaging Het
Slc10a5 A T 3: 10,399,685 (GRCm39) V325E possibly damaging Het
Slc5a9 C A 4: 111,748,941 (GRCm39) probably null Het
Sptbn2 C T 19: 4,788,497 (GRCm39) R1159C probably damaging Het
Stk36 A G 1: 74,642,415 (GRCm39) D14G probably damaging Het
Thap2 T C 10: 115,208,601 (GRCm39) K173R probably damaging Het
Themis2 G T 4: 132,510,668 (GRCm39) Q625K probably benign Het
Vcpip1 G T 1: 9,818,287 (GRCm39) P32Q unknown Het
Vmn1r229 A T 17: 21,035,081 (GRCm39) T109S probably damaging Het
Vps13b T A 15: 35,640,661 (GRCm39) probably null Het
Wdr64 A G 1: 175,526,345 (GRCm39) probably benign Het
Wiz A G 17: 32,576,602 (GRCm39) S642P possibly damaging Het
Zdhhc1 C T 8: 106,199,649 (GRCm39) R383Q probably benign Het
Zfp462 T C 4: 55,060,055 (GRCm39) S1194P probably damaging Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116,805,008 (GRCm39) missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116,864,607 (GRCm39) missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116,837,317 (GRCm39) splice site probably benign
IGL02339:Ptprn2 APN 12 116,685,724 (GRCm39) missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116,852,518 (GRCm39) missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117,175,563 (GRCm39) missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116,839,964 (GRCm39) nonsense probably null
BB001:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117,212,308 (GRCm39) missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0694:Ptprn2 UTSW 12 116,787,975 (GRCm39) missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116,685,750 (GRCm39) nonsense probably null
R0746:Ptprn2 UTSW 12 116,864,637 (GRCm39) missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117,175,628 (GRCm39) splice site probably null
R1443:Ptprn2 UTSW 12 117,217,235 (GRCm39) missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117,148,342 (GRCm39) missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117,125,329 (GRCm39) missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116,685,792 (GRCm39) missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116,544,048 (GRCm39) missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117,211,337 (GRCm39) missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116,685,753 (GRCm39) missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116,852,497 (GRCm39) missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116,864,628 (GRCm39) missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116,839,620 (GRCm39) missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116,835,714 (GRCm39) missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116,788,016 (GRCm39) missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117,211,393 (GRCm39) nonsense probably null
R4872:Ptprn2 UTSW 12 117,125,314 (GRCm39) missense probably damaging 1.00
R4970:Ptprn2 UTSW 12 117,240,215 (GRCm39) missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116,822,548 (GRCm39) missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117,175,482 (GRCm39) missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117,148,267 (GRCm39) missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116,822,739 (GRCm39) missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117,233,209 (GRCm39) missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116,835,658 (GRCm39) missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117,190,820 (GRCm39) missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116,852,508 (GRCm39) missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116,835,676 (GRCm39) missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117,190,845 (GRCm39) splice site probably null
R7237:Ptprn2 UTSW 12 117,125,347 (GRCm39) missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117,212,164 (GRCm39) missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116,822,571 (GRCm39) missense probably benign
R7460:Ptprn2 UTSW 12 117,212,301 (GRCm39) missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116,449,486 (GRCm39) start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116,685,739 (GRCm39) missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116,804,940 (GRCm39) missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117,148,357 (GRCm39) missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117,219,168 (GRCm39) missense possibly damaging 0.73
R9235:Ptprn2 UTSW 12 117,233,271 (GRCm39) critical splice donor site probably null
R9605:Ptprn2 UTSW 12 117,125,278 (GRCm39) missense probably benign 0.13
X0066:Ptprn2 UTSW 12 117,148,360 (GRCm39) missense probably benign 0.16
X0066:Ptprn2 UTSW 12 117,125,380 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTATGTTAGTAGCCATGGG -3'
(R):5'- GATAAACTGTATTTGGGGCGC -3'

Sequencing Primer
(F):5'- TAGCCATGGGTACAAGCTGTGC -3'
(R):5'- AAACTGTATTTGGGGCGCATTTTTC -3'
Posted On 2016-03-17