Incidental Mutation 'R4892:Syndig1'
ID 377333
Institutional Source Beutler Lab
Gene Symbol Syndig1
Ensembl Gene ENSMUSG00000074736
Gene Name synapse differentiation inducing 1
Synonyms Tmem90b, SynDIG1
MMRRC Submission 042497-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock # R4892 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 149829211-150004392 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 149899891 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 132 (K132N)
Ref Sequence ENSEMBL: ENSMUSP00000105561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109934] [ENSMUST00000109935] [ENSMUST00000137280] [ENSMUST00000140870] [ENSMUST00000144179] [ENSMUST00000149705]
AlphaFold A2ANU3
Predicted Effect probably damaging
Transcript: ENSMUST00000109934
AA Change: K132N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105560
Gene: ENSMUSG00000074736
AA Change: K132N

DomainStartEndE-ValueType
Pfam:Dispanin 164 246 5.8e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109935
AA Change: K132N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105561
Gene: ENSMUSG00000074736
AA Change: K132N

DomainStartEndE-ValueType
low complexity region 151 171 N/A INTRINSIC
Pfam:CD225 172 244 7.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137280
Predicted Effect probably benign
Transcript: ENSMUST00000140870
Predicted Effect probably benign
Transcript: ENSMUST00000144179
Predicted Effect probably benign
Transcript: ENSMUST00000149705
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the interferon-induced transmembrane family of proteins. A similar protein in rat is thought to regulate the development of excitatory synapses. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,509,802 T1128A probably benign Het
Apol11a A T 15: 77,516,990 K226* probably null Het
Atp4a A G 7: 30,712,474 M45V probably benign Het
Babam1 T A 8: 71,403,052 M263K probably benign Het
Capn11 GACA GA 17: 45,633,097 probably null Het
Ccdc190 C A 1: 169,930,109 L46I possibly damaging Het
Cep131 C T 11: 120,068,057 R717H probably damaging Het
Cpt1c A G 7: 44,959,588 F770L probably benign Het
Dhx30 A T 9: 110,085,856 probably null Het
Dido1 G A 2: 180,675,029 Q662* probably null Het
Dip2a T C 10: 76,280,759 E910G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fmo3 T A 1: 162,968,731 I91F probably benign Het
Gdap1 A C 1: 17,159,994 D217A possibly damaging Het
Grm1 T C 10: 10,719,587 S766G possibly damaging Het
Kat8 T A 7: 127,915,538 I123N possibly damaging Het
Kcnt2 C A 1: 140,513,025 S23* probably null Het
Krt73 G A 15: 101,795,809 T432I probably damaging Het
Lgals9 T A 11: 78,966,083 I223L probably benign Het
Mpo T A 11: 87,802,681 N48K probably benign Het
Myo9a T G 9: 59,824,242 H632Q probably damaging Het
Olfr1386 C A 11: 49,470,216 Q22K probably benign Het
Olfr1412 A G 1: 92,588,921 N197S probably benign Het
Prelid2 A G 18: 41,951,144 F11S possibly damaging Het
Setd1a G T 7: 127,778,524 V57L probably damaging Het
Sgip1 A G 4: 102,966,234 D704G probably damaging Het
Spryd3 T C 15: 102,118,102 E378G probably benign Het
Stk17b A T 1: 53,771,611 Y112N probably damaging Het
Tcf20 C T 15: 82,854,199 R1017Q possibly damaging Het
Tenm3 T A 8: 48,276,861 D1370V probably damaging Het
Tnrc6a C T 7: 123,169,911 T308I probably damaging Het
Ttc29 T C 8: 78,333,645 V398A probably damaging Het
Ubr4 A G 4: 139,428,517 T2218A probably benign Het
Other mutations in Syndig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Syndig1 APN 2 149899757 missense probably damaging 1.00
IGL01599:Syndig1 APN 2 150003283 missense probably damaging 1.00
IGL01814:Syndig1 APN 2 149899770 missense probably damaging 1.00
IGL01988:Syndig1 APN 2 150003170 splice site probably benign
IGL02323:Syndig1 APN 2 149899787 missense probably benign 0.00
R1445:Syndig1 UTSW 2 149930921 missense probably damaging 1.00
R1523:Syndig1 UTSW 2 150003234 missense probably damaging 1.00
R4825:Syndig1 UTSW 2 149899553 missense probably damaging 0.99
R5643:Syndig1 UTSW 2 149899508 missense possibly damaging 0.78
R5644:Syndig1 UTSW 2 149899508 missense possibly damaging 0.78
R6386:Syndig1 UTSW 2 149899576 missense probably damaging 1.00
R6603:Syndig1 UTSW 2 150003288 missense probably damaging 1.00
R7941:Syndig1 UTSW 2 149899788 missense probably benign 0.37
R8177:Syndig1 UTSW 2 149899868 missense probably damaging 1.00
R9265:Syndig1 UTSW 2 150003240 missense probably damaging 0.98
R9340:Syndig1 UTSW 2 150003255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTGCTGGACCCAAACAC -3'
(R):5'- AAGTAGTACCGAGAATACCTTCAGC -3'

Sequencing Primer
(F):5'- ACACTCTGCAGCAGTCCGTC -3'
(R):5'- GCATGATAATTTCACTCCCAGGG -3'
Posted On 2016-03-17