Mutagenetix > Incidental Mutations

Incidental Mutation 'R4892:Tnrc6a'

377340

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6a

Ensembl Gene

ENSMUSG00000052707

Gene Name

trinucleotide repeat containing 6a

Synonyms

CAGH26, 2010321I05Rik, Tnrc6, 3110054G10Rik, D130023A07Rik

MMRRC Submission

042497-MU

Accession Numbers

Genbank: NM_144925; MGI: 2385292

Is this an essential gene?

Probably essential (E-score: 0.779) question?

Stock #

R4892 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123123885-123195296 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 123169911 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 308 (T308I)

Ref Sequence

ENSEMBL: ENSMUSP00000091595 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094053] [ENSMUST00000205514] [ENSMUST00000206014] [ENSMUST00000206888]

AlphaFold

Q3UHK8

Predicted Effect

probably damaging
Transcript: ENSMUST00000094053
AA Change: T308I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000091595
Gene: ENSMUSG00000052707
AA Change: T308I

Domain	Start	End	E-Value	Type
coiled coil region	5	54	N/A	INTRINSIC
low complexity region	69	92	N/A	INTRINSIC
low complexity region	93	113	N/A	INTRINSIC
low complexity region	281	294	N/A	INTRINSIC
low complexity region	430	443	N/A	INTRINSIC
low complexity region	568	590	N/A	INTRINSIC
internal_repeat_1	690	853	3.51e-6	PROSPERO
low complexity region	858	871	N/A	INTRINSIC
Pfam:Ago_hook	1028	1190	1.2e-29	PFAM
low complexity region	1284	1296	N/A	INTRINSIC
low complexity region	1301	1316	N/A	INTRINSIC
low complexity region	1337	1376	N/A	INTRINSIC
low complexity region	1386	1392	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1439	1714	1.5e-126	PFAM
RRM	1717	1784	4.95e-2	SMART
low complexity region	1808	1820	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205449

Predicted Effect

probably benign
Transcript: ENSMUST00000205514

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205732

Predicted Effect

probably benign
Transcript: ENSMUST00000205760

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205789

Predicted Effect

probably benign
Transcript: ENSMUST00000206014

Predicted Effect

probably benign
Transcript: ENSMUST00000206888

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206922

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211170

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein is highly similar to a human protein that functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The human protein associates with messenger RNAs and argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies, and inhibiting its expression delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial embryonic lethality during organogenesis associated with impaired hematopoiesis. [provided by MGI curators]

Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	T	C	8: 86,509,802	T1128A	probably benign	Het
Apol11a	A	T	15: 77,516,990	K226*	probably null	Het
Atp4a	A	G	7: 30,712,474	M45V	probably benign	Het
Babam1	T	A	8: 71,403,052	M263K	probably benign	Het
Capn11	GACA	GA	17: 45,633,097		probably null	Het
Ccdc190	C	A	1: 169,930,109	L46I	possibly damaging	Het
Cep131	C	T	11: 120,068,057	R717H	probably damaging	Het
Cpt1c	A	G	7: 44,959,588	F770L	probably benign	Het
Dhx30	A	T	9: 110,085,856		probably null	Het
Dido1	G	A	2: 180,675,029	Q662*	probably null	Het
Dip2a	T	C	10: 76,280,759	E910G	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Fmo3	T	A	1: 162,968,731	I91F	probably benign	Het
Gdap1	A	C	1: 17,159,994	D217A	possibly damaging	Het
Grm1	T	C	10: 10,719,587	S766G	possibly damaging	Het
Kat8	T	A	7: 127,915,538	I123N	possibly damaging	Het
Kcnt2	C	A	1: 140,513,025	S23*	probably null	Het
Krt73	G	A	15: 101,795,809	T432I	probably damaging	Het
Lgals9	T	A	11: 78,966,083	I223L	probably benign	Het
Mpo	T	A	11: 87,802,681	N48K	probably benign	Het
Myo9a	T	G	9: 59,824,242	H632Q	probably damaging	Het
Olfr1386	C	A	11: 49,470,216	Q22K	probably benign	Het
Olfr1412	A	G	1: 92,588,921	N197S	probably benign	Het
Prelid2	A	G	18: 41,951,144	F11S	possibly damaging	Het
Setd1a	G	T	7: 127,778,524	V57L	probably damaging	Het
Sgip1	A	G	4: 102,966,234	D704G	probably damaging	Het
Spryd3	T	C	15: 102,118,102	E378G	probably benign	Het
Stk17b	A	T	1: 53,771,611	Y112N	probably damaging	Het
Syndig1	A	T	2: 149,899,891	K132N	probably damaging	Het
Tcf20	C	T	15: 82,854,199	R1017Q	possibly damaging	Het
Tenm3	T	A	8: 48,276,861	D1370V	probably damaging	Het
Ttc29	T	C	8: 78,333,645	V398A	probably damaging	Het
Ubr4	A	G	4: 139,428,517	T2218A	probably benign	Het

Other mutations in Tnrc6a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Tnrc6a	APN	7	123170780	missense	probably benign	0.04
IGL00580:Tnrc6a	APN	7	123174278	missense	probably damaging	1.00
IGL01309:Tnrc6a	APN	7	123171494	missense	probably benign	0.04
IGL02004:Tnrc6a	APN	7	123181366	missense	possibly damaging	0.57
IGL02142:Tnrc6a	APN	7	123152191	intron	probably benign
IGL02220:Tnrc6a	APN	7	123170456	missense	probably benign
IGL02436:Tnrc6a	APN	7	123184215	nonsense	probably null
IGL02670:Tnrc6a	APN	7	123171312	missense	possibly damaging	0.92
IGL02743:Tnrc6a	APN	7	123171473	missense	probably damaging	1.00
0152:Tnrc6a	UTSW	7	123180654	missense	probably damaging	1.00
R0008:Tnrc6a	UTSW	7	123170394	missense	probably benign	0.00
R0008:Tnrc6a	UTSW	7	123170394	missense	probably benign	0.00
R0369:Tnrc6a	UTSW	7	123170860	missense	probably damaging	1.00
R0512:Tnrc6a	UTSW	7	123186728	splice site	probably benign
R0566:Tnrc6a	UTSW	7	123170913	missense	probably benign	0.00
R0600:Tnrc6a	UTSW	7	123171816	missense	probably benign	0.14
R0751:Tnrc6a	UTSW	7	123170340	missense	possibly damaging	0.73
R1184:Tnrc6a	UTSW	7	123170340	missense	possibly damaging	0.73
R1319:Tnrc6a	UTSW	7	123184251	missense	probably benign	0.02
R1405:Tnrc6a	UTSW	7	123171078	missense	probably damaging	1.00
R1405:Tnrc6a	UTSW	7	123171078	missense	probably damaging	1.00
R1585:Tnrc6a	UTSW	7	123176875	missense	probably benign	0.08
R1709:Tnrc6a	UTSW	7	123169982	missense	probably benign	0.10
R1776:Tnrc6a	UTSW	7	123171297	missense	probably damaging	1.00
R1791:Tnrc6a	UTSW	7	123192917	missense	possibly damaging	0.47
R1807:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R1876:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R2010:Tnrc6a	UTSW	7	123171046	missense	probably benign	0.26
R2086:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R2089:Tnrc6a	UTSW	7	123172120	critical splice donor site	probably null
R2091:Tnrc6a	UTSW	7	123172120	critical splice donor site	probably null
R2091:Tnrc6a	UTSW	7	123172120	critical splice donor site	probably null
R2511:Tnrc6a	UTSW	7	123171092	missense	probably damaging	1.00
R2830:Tnrc6a	UTSW	7	123192949	makesense	probably null
R2850:Tnrc6a	UTSW	7	123179800	missense	probably damaging	1.00
R3916:Tnrc6a	UTSW	7	123181384	missense	probably damaging	1.00
R4028:Tnrc6a	UTSW	7	123170121	missense	probably damaging	1.00
R4235:Tnrc6a	UTSW	7	123171680	missense	probably benign	0.00
R4439:Tnrc6a	UTSW	7	123152182	nonsense	probably null
R4525:Tnrc6a	UTSW	7	123179782	missense	probably benign
R4578:Tnrc6a	UTSW	7	123184221	missense	possibly damaging	0.89
R4613:Tnrc6a	UTSW	7	123184289	critical splice donor site	probably null
R4711:Tnrc6a	UTSW	7	123171078	missense	probably damaging	1.00
R4722:Tnrc6a	UTSW	7	123192090	missense	possibly damaging	0.78
R4746:Tnrc6a	UTSW	7	123189997	missense	probably damaging	1.00
R4942:Tnrc6a	UTSW	7	123192613	missense	probably damaging	0.99
R4967:Tnrc6a	UTSW	7	123189872	missense	probably damaging	1.00
R5064:Tnrc6a	UTSW	7	123186723	critical splice donor site	probably null
R5239:Tnrc6a	UTSW	7	123186619	missense	probably benign
R5604:Tnrc6a	UTSW	7	123174236	missense	probably damaging	0.97
R5805:Tnrc6a	UTSW	7	123170076	missense	probably damaging	0.97
R5942:Tnrc6a	UTSW	7	123186665	missense	probably damaging	1.00
R5988:Tnrc6a	UTSW	7	123182380	missense	probably damaging	0.96
R6212:Tnrc6a	UTSW	7	123143742	splice site	probably null
R6284:Tnrc6a	UTSW	7	123171335	missense	probably damaging	0.99
R6417:Tnrc6a	UTSW	7	123171074	missense	probably benign	0.01
R6420:Tnrc6a	UTSW	7	123171074	missense	probably benign	0.01
R6575:Tnrc6a	UTSW	7	123169910	missense	probably damaging	1.00
R6760:Tnrc6a	UTSW	7	123171999	missense	probably damaging	1.00
R6886:Tnrc6a	UTSW	7	123187445	missense	probably benign	0.17
R6968:Tnrc6a	UTSW	7	123182427	missense	probably benign	0.05
R7216:Tnrc6a	UTSW	7	123171495	missense	probably benign	0.01
R7260:Tnrc6a	UTSW	7	123186590	missense	probably benign	0.36
R7299:Tnrc6a	UTSW	7	123170913	missense	probably benign
R7322:Tnrc6a	UTSW	7	123171508	missense	probably benign	0.09
R7500:Tnrc6a	UTSW	7	123173450	splice site	probably null
R7872:Tnrc6a	UTSW	7	123179834	missense	probably damaging	0.99
R8270:Tnrc6a	UTSW	7	123170071	missense	possibly damaging	0.92
R8313:Tnrc6a	UTSW	7	123170713	missense	possibly damaging	0.92
R8348:Tnrc6a	UTSW	7	123192123	missense	possibly damaging	0.65
R8390:Tnrc6a	UTSW	7	123162571	missense	probably damaging	0.97
R8448:Tnrc6a	UTSW	7	123192123	missense	possibly damaging	0.65
R8514:Tnrc6a	UTSW	7	123184215	nonsense	probably null
R8552:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R8767:Tnrc6a	UTSW	7	123183910	unclassified	probably benign
R9047:Tnrc6a	UTSW	7	123179723	missense	probably damaging	1.00
R9153:Tnrc6a	UTSW	7	123174296	missense	probably damaging	1.00
R9166:Tnrc6a	UTSW	7	123187401	missense	probably damaging	1.00
R9179:Tnrc6a	UTSW	7	123192658	missense	probably benign	0.44
R9192:Tnrc6a	UTSW	7	123189953	missense	probably damaging	1.00
R9457:Tnrc6a	UTSW	7	123179735	missense	probably benign	0.24
X0064:Tnrc6a	UTSW	7	123169798	missense	probably benign	0.28
Z1176:Tnrc6a	UTSW	7	123162496	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTATAGATGCTGATTCTGCCTC -3'
(R):5'- TCCCTACAGGCCCTTTTAGG -3'

Sequencing Primer
(F):5'- TGCCTCCAATTCTGAGTCAGAGAG -3'
(R):5'- CCTTTTAGGGCAAGTCCATTG -3'

Posted On

2016-03-17