Incidental Mutation 'R4892:Tnrc6a'
ID 377340
Institutional Source Beutler Lab
Gene Symbol Tnrc6a
Ensembl Gene ENSMUSG00000052707
Gene Name trinucleotide repeat containing 6a
Synonyms 3110054G10Rik, 2010321I05Rik, Tnrc6, CAGH26, D130023A07Rik
MMRRC Submission 042497-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.850) question?
Stock # R4892 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 122723108-122794519 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 122769134 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 308 (T308I)
Ref Sequence ENSEMBL: ENSMUSP00000091595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094053] [ENSMUST00000205514] [ENSMUST00000206014] [ENSMUST00000206888]
AlphaFold Q3UHK8
Predicted Effect probably damaging
Transcript: ENSMUST00000094053
AA Change: T308I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091595
Gene: ENSMUSG00000052707
AA Change: T308I

DomainStartEndE-ValueType
coiled coil region 5 54 N/A INTRINSIC
low complexity region 69 92 N/A INTRINSIC
low complexity region 93 113 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
low complexity region 430 443 N/A INTRINSIC
low complexity region 568 590 N/A INTRINSIC
internal_repeat_1 690 853 3.51e-6 PROSPERO
low complexity region 858 871 N/A INTRINSIC
Pfam:Ago_hook 1028 1190 1.2e-29 PFAM
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1301 1316 N/A INTRINSIC
low complexity region 1337 1376 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1439 1714 1.5e-126 PFAM
RRM 1717 1784 4.95e-2 SMART
low complexity region 1808 1820 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205449
Predicted Effect probably benign
Transcript: ENSMUST00000205514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205732
Predicted Effect probably benign
Transcript: ENSMUST00000205760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205789
Predicted Effect probably benign
Transcript: ENSMUST00000206014
Predicted Effect probably benign
Transcript: ENSMUST00000206888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206922
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein is highly similar to a human protein that functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The human protein associates with messenger RNAs and argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies, and inhibiting its expression delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial embryonic lethality during organogenesis associated with impaired hematopoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 87,236,431 (GRCm39) T1128A probably benign Het
Apol11a A T 15: 77,401,190 (GRCm39) K226* probably null Het
Atp4a A G 7: 30,411,899 (GRCm39) M45V probably benign Het
Babam1 T A 8: 71,855,696 (GRCm39) M263K probably benign Het
Capn11 GACA GA 17: 45,944,023 (GRCm39) probably null Het
Ccdc190 C A 1: 169,757,678 (GRCm39) L46I possibly damaging Het
Cep131 C T 11: 119,958,883 (GRCm39) R717H probably damaging Het
Cpt1c A G 7: 44,609,012 (GRCm39) F770L probably benign Het
Dhx30 A T 9: 109,914,924 (GRCm39) probably null Het
Dido1 G A 2: 180,316,822 (GRCm39) Q662* probably null Het
Dip2a T C 10: 76,116,593 (GRCm39) E910G probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Fmo3 T A 1: 162,796,300 (GRCm39) I91F probably benign Het
Gdap1 A C 1: 17,230,218 (GRCm39) D217A possibly damaging Het
Grm1 T C 10: 10,595,331 (GRCm39) S766G possibly damaging Het
Kat8 T A 7: 127,514,710 (GRCm39) I123N possibly damaging Het
Kcnt2 C A 1: 140,440,763 (GRCm39) S23* probably null Het
Krt73 G A 15: 101,704,244 (GRCm39) T432I probably damaging Het
Lgals9 T A 11: 78,856,909 (GRCm39) I223L probably benign Het
Mpo T A 11: 87,693,507 (GRCm39) N48K probably benign Het
Myo9a T G 9: 59,731,525 (GRCm39) H632Q probably damaging Het
Or2y1c C A 11: 49,361,043 (GRCm39) Q22K probably benign Het
Or9s27 A G 1: 92,516,643 (GRCm39) N197S probably benign Het
Prelid2 A G 18: 42,084,209 (GRCm39) F11S possibly damaging Het
Setd1a G T 7: 127,377,696 (GRCm39) V57L probably damaging Het
Sgip1 A G 4: 102,823,431 (GRCm39) D704G probably damaging Het
Spryd3 T C 15: 102,026,537 (GRCm39) E378G probably benign Het
Stk17b A T 1: 53,810,770 (GRCm39) Y112N probably damaging Het
Syndig1 A T 2: 149,741,811 (GRCm39) K132N probably damaging Het
Tcf20 C T 15: 82,738,400 (GRCm39) R1017Q possibly damaging Het
Tenm3 T A 8: 48,729,896 (GRCm39) D1370V probably damaging Het
Ttc29 T C 8: 79,060,274 (GRCm39) V398A probably damaging Het
Ubr4 A G 4: 139,155,828 (GRCm39) T2218A probably benign Het
Other mutations in Tnrc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Tnrc6a APN 7 122,770,003 (GRCm39) missense probably benign 0.04
IGL00580:Tnrc6a APN 7 122,773,501 (GRCm39) missense probably damaging 1.00
IGL01309:Tnrc6a APN 7 122,770,717 (GRCm39) missense probably benign 0.04
IGL02004:Tnrc6a APN 7 122,780,589 (GRCm39) missense possibly damaging 0.57
IGL02142:Tnrc6a APN 7 122,751,414 (GRCm39) intron probably benign
IGL02220:Tnrc6a APN 7 122,769,679 (GRCm39) missense probably benign
IGL02436:Tnrc6a APN 7 122,783,438 (GRCm39) nonsense probably null
IGL02670:Tnrc6a APN 7 122,770,535 (GRCm39) missense possibly damaging 0.92
IGL02743:Tnrc6a APN 7 122,770,696 (GRCm39) missense probably damaging 1.00
0152:Tnrc6a UTSW 7 122,779,877 (GRCm39) missense probably damaging 1.00
R0008:Tnrc6a UTSW 7 122,769,617 (GRCm39) missense probably benign 0.00
R0008:Tnrc6a UTSW 7 122,769,617 (GRCm39) missense probably benign 0.00
R0369:Tnrc6a UTSW 7 122,770,083 (GRCm39) missense probably damaging 1.00
R0512:Tnrc6a UTSW 7 122,785,951 (GRCm39) splice site probably benign
R0566:Tnrc6a UTSW 7 122,770,136 (GRCm39) missense probably benign 0.00
R0600:Tnrc6a UTSW 7 122,771,039 (GRCm39) missense probably benign 0.14
R0751:Tnrc6a UTSW 7 122,769,563 (GRCm39) missense possibly damaging 0.73
R1184:Tnrc6a UTSW 7 122,769,563 (GRCm39) missense possibly damaging 0.73
R1319:Tnrc6a UTSW 7 122,783,474 (GRCm39) missense probably benign 0.02
R1405:Tnrc6a UTSW 7 122,770,301 (GRCm39) missense probably damaging 1.00
R1405:Tnrc6a UTSW 7 122,770,301 (GRCm39) missense probably damaging 1.00
R1585:Tnrc6a UTSW 7 122,776,098 (GRCm39) missense probably benign 0.08
R1709:Tnrc6a UTSW 7 122,769,205 (GRCm39) missense probably benign 0.10
R1776:Tnrc6a UTSW 7 122,770,520 (GRCm39) missense probably damaging 1.00
R1791:Tnrc6a UTSW 7 122,792,140 (GRCm39) missense possibly damaging 0.47
R1807:Tnrc6a UTSW 7 122,761,669 (GRCm39) splice site probably benign
R1876:Tnrc6a UTSW 7 122,761,669 (GRCm39) splice site probably benign
R2010:Tnrc6a UTSW 7 122,770,269 (GRCm39) missense probably benign 0.26
R2086:Tnrc6a UTSW 7 122,761,669 (GRCm39) splice site probably benign
R2089:Tnrc6a UTSW 7 122,771,343 (GRCm39) critical splice donor site probably null
R2091:Tnrc6a UTSW 7 122,771,343 (GRCm39) critical splice donor site probably null
R2091:Tnrc6a UTSW 7 122,771,343 (GRCm39) critical splice donor site probably null
R2511:Tnrc6a UTSW 7 122,770,315 (GRCm39) missense probably damaging 1.00
R2830:Tnrc6a UTSW 7 122,792,172 (GRCm39) makesense probably null
R2850:Tnrc6a UTSW 7 122,779,023 (GRCm39) missense probably damaging 1.00
R3916:Tnrc6a UTSW 7 122,780,607 (GRCm39) missense probably damaging 1.00
R4028:Tnrc6a UTSW 7 122,769,344 (GRCm39) missense probably damaging 1.00
R4235:Tnrc6a UTSW 7 122,770,903 (GRCm39) missense probably benign 0.00
R4439:Tnrc6a UTSW 7 122,751,405 (GRCm39) nonsense probably null
R4525:Tnrc6a UTSW 7 122,779,005 (GRCm39) missense probably benign
R4578:Tnrc6a UTSW 7 122,783,444 (GRCm39) missense possibly damaging 0.89
R4613:Tnrc6a UTSW 7 122,783,512 (GRCm39) critical splice donor site probably null
R4711:Tnrc6a UTSW 7 122,770,301 (GRCm39) missense probably damaging 1.00
R4722:Tnrc6a UTSW 7 122,791,313 (GRCm39) missense possibly damaging 0.78
R4746:Tnrc6a UTSW 7 122,789,220 (GRCm39) missense probably damaging 1.00
R4942:Tnrc6a UTSW 7 122,791,836 (GRCm39) missense probably damaging 0.99
R4967:Tnrc6a UTSW 7 122,789,095 (GRCm39) missense probably damaging 1.00
R5064:Tnrc6a UTSW 7 122,785,946 (GRCm39) critical splice donor site probably null
R5239:Tnrc6a UTSW 7 122,785,842 (GRCm39) missense probably benign
R5604:Tnrc6a UTSW 7 122,773,459 (GRCm39) missense probably damaging 0.97
R5805:Tnrc6a UTSW 7 122,769,299 (GRCm39) missense probably damaging 0.97
R5942:Tnrc6a UTSW 7 122,785,888 (GRCm39) missense probably damaging 1.00
R5988:Tnrc6a UTSW 7 122,781,603 (GRCm39) missense probably damaging 0.96
R6212:Tnrc6a UTSW 7 122,742,965 (GRCm39) splice site probably null
R6284:Tnrc6a UTSW 7 122,770,558 (GRCm39) missense probably damaging 0.99
R6417:Tnrc6a UTSW 7 122,770,297 (GRCm39) missense probably benign 0.01
R6420:Tnrc6a UTSW 7 122,770,297 (GRCm39) missense probably benign 0.01
R6575:Tnrc6a UTSW 7 122,769,133 (GRCm39) missense probably damaging 1.00
R6760:Tnrc6a UTSW 7 122,771,222 (GRCm39) missense probably damaging 1.00
R6886:Tnrc6a UTSW 7 122,786,668 (GRCm39) missense probably benign 0.17
R6968:Tnrc6a UTSW 7 122,781,650 (GRCm39) missense probably benign 0.05
R7216:Tnrc6a UTSW 7 122,770,718 (GRCm39) missense probably benign 0.01
R7260:Tnrc6a UTSW 7 122,785,813 (GRCm39) missense probably benign 0.36
R7299:Tnrc6a UTSW 7 122,770,136 (GRCm39) missense probably benign
R7322:Tnrc6a UTSW 7 122,770,731 (GRCm39) missense probably benign 0.09
R7500:Tnrc6a UTSW 7 122,772,673 (GRCm39) splice site probably null
R7872:Tnrc6a UTSW 7 122,779,057 (GRCm39) missense probably damaging 0.99
R8270:Tnrc6a UTSW 7 122,769,294 (GRCm39) missense possibly damaging 0.92
R8313:Tnrc6a UTSW 7 122,769,936 (GRCm39) missense possibly damaging 0.92
R8348:Tnrc6a UTSW 7 122,791,346 (GRCm39) missense possibly damaging 0.65
R8390:Tnrc6a UTSW 7 122,761,794 (GRCm39) missense probably damaging 0.97
R8448:Tnrc6a UTSW 7 122,791,346 (GRCm39) missense possibly damaging 0.65
R8514:Tnrc6a UTSW 7 122,783,438 (GRCm39) nonsense probably null
R8552:Tnrc6a UTSW 7 122,761,669 (GRCm39) splice site probably benign
R8767:Tnrc6a UTSW 7 122,783,133 (GRCm39) unclassified probably benign
R9047:Tnrc6a UTSW 7 122,778,946 (GRCm39) missense probably damaging 1.00
R9147:Tnrc6a UTSW 7 122,785,667 (GRCm39) intron probably benign
R9153:Tnrc6a UTSW 7 122,773,519 (GRCm39) missense probably damaging 1.00
R9166:Tnrc6a UTSW 7 122,786,624 (GRCm39) missense probably damaging 1.00
R9179:Tnrc6a UTSW 7 122,791,881 (GRCm39) missense probably benign 0.44
R9192:Tnrc6a UTSW 7 122,789,176 (GRCm39) missense probably damaging 1.00
R9457:Tnrc6a UTSW 7 122,778,958 (GRCm39) missense probably benign 0.24
R9778:Tnrc6a UTSW 7 122,769,635 (GRCm39) missense probably benign 0.43
X0064:Tnrc6a UTSW 7 122,769,021 (GRCm39) missense probably benign 0.28
Z1176:Tnrc6a UTSW 7 122,761,719 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATAGATGCTGATTCTGCCTC -3'
(R):5'- TCCCTACAGGCCCTTTTAGG -3'

Sequencing Primer
(F):5'- TGCCTCCAATTCTGAGTCAGAGAG -3'
(R):5'- CCTTTTAGGGCAAGTCCATTG -3'
Posted On 2016-03-17