Incidental Mutation 'R4892:Kat8'
ID 377342
Institutional Source Beutler Lab
Gene Symbol Kat8
Ensembl Gene ENSMUSG00000030801
Gene Name K(lysine) acetyltransferase 8
Synonyms 5830450F21Rik, 2010203C02Rik, Myst1, MOF, D7Ertd629e
MMRRC Submission 042497-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4892 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 127912516-127925837 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127915538 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 123 (I123N)
Ref Sequence ENSEMBL: ENSMUSP00000145731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033070] [ENSMUST00000205357]
AlphaFold Q9D1P2
Predicted Effect probably benign
Transcript: ENSMUST00000033070
AA Change: I149N

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000033070
Gene: ENSMUSG00000030801
AA Change: I149N

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
CHROMO 69 123 6.6e-8 SMART
Blast:PHD 177 214 4e-6 BLAST
Pfam:MOZ_SAS 235 412 5.7e-90 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205357
AA Change: I123N

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206364
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MYST histone acetylase protein family. The encoded protein has a characteristic MYST domain containing an acetyl-CoA-binding site, a chromodomain typical of proteins which bind histones, and a C2HC-type zinc finger. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele die prior to gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,509,802 T1128A probably benign Het
Apol11a A T 15: 77,516,990 K226* probably null Het
Atp4a A G 7: 30,712,474 M45V probably benign Het
Babam1 T A 8: 71,403,052 M263K probably benign Het
Capn11 GACA GA 17: 45,633,097 probably null Het
Ccdc190 C A 1: 169,930,109 L46I possibly damaging Het
Cep131 C T 11: 120,068,057 R717H probably damaging Het
Cpt1c A G 7: 44,959,588 F770L probably benign Het
Dhx30 A T 9: 110,085,856 probably null Het
Dido1 G A 2: 180,675,029 Q662* probably null Het
Dip2a T C 10: 76,280,759 E910G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fmo3 T A 1: 162,968,731 I91F probably benign Het
Gdap1 A C 1: 17,159,994 D217A possibly damaging Het
Grm1 T C 10: 10,719,587 S766G possibly damaging Het
Kcnt2 C A 1: 140,513,025 S23* probably null Het
Krt73 G A 15: 101,795,809 T432I probably damaging Het
Lgals9 T A 11: 78,966,083 I223L probably benign Het
Mpo T A 11: 87,802,681 N48K probably benign Het
Myo9a T G 9: 59,824,242 H632Q probably damaging Het
Olfr1386 C A 11: 49,470,216 Q22K probably benign Het
Olfr1412 A G 1: 92,588,921 N197S probably benign Het
Prelid2 A G 18: 41,951,144 F11S possibly damaging Het
Setd1a G T 7: 127,778,524 V57L probably damaging Het
Sgip1 A G 4: 102,966,234 D704G probably damaging Het
Spryd3 T C 15: 102,118,102 E378G probably benign Het
Stk17b A T 1: 53,771,611 Y112N probably damaging Het
Syndig1 A T 2: 149,899,891 K132N probably damaging Het
Tcf20 C T 15: 82,854,199 R1017Q possibly damaging Het
Tenm3 T A 8: 48,276,861 D1370V probably damaging Het
Tnrc6a C T 7: 123,169,911 T308I probably damaging Het
Ttc29 T C 8: 78,333,645 V398A probably damaging Het
Ubr4 A G 4: 139,428,517 T2218A probably benign Het
Other mutations in Kat8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Kat8 APN 7 127920504 missense probably damaging 1.00
R0853:Kat8 UTSW 7 127925224 missense probably benign 0.12
R1293:Kat8 UTSW 7 127922250 critical splice donor site probably null
R1926:Kat8 UTSW 7 127915295 nonsense probably null
R3824:Kat8 UTSW 7 127924482 missense possibly damaging 0.56
R4841:Kat8 UTSW 7 127925194 missense probably benign 0.11
R5102:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5104:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5722:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5723:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5724:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5734:Kat8 UTSW 7 127920579 missense probably benign 0.00
R5820:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5821:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R7059:Kat8 UTSW 7 127924903 missense probably benign
R7158:Kat8 UTSW 7 127922159 missense probably benign
R8263:Kat8 UTSW 7 127924481 missense possibly damaging 0.94
R8941:Kat8 UTSW 7 127925228 missense probably damaging 0.99
R9173:Kat8 UTSW 7 127912691 missense probably benign
R9424:Kat8 UTSW 7 127924928 missense probably benign 0.34
R9452:Kat8 UTSW 7 127925249 missense probably benign 0.00
X0027:Kat8 UTSW 7 127925258 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCGTCCTAACAGTTAACAGGCG -3'
(R):5'- ATGAGATCGTCCAGTGCTCG -3'

Sequencing Primer
(F):5'- CGACTGGACGAATGGGTG -3'
(R):5'- GACTTCAAGTTTGAGTTCCAGTC -3'
Posted On 2016-03-17