Incidental Mutation 'R4892:Babam1'
ID 377344
Institutional Source Beutler Lab
Gene Symbol Babam1
Ensembl Gene ENSMUSG00000031820
Gene Name BRISC and BRCA1 A complex member 1
Synonyms 5430437P03Rik
MMRRC Submission 042497-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock # R4892 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 71396861-71404619 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 71403052 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 263 (M263K)
Ref Sequence ENSEMBL: ENSMUSP00000002473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002473] [ENSMUST00000119976] [ENSMUST00000120725]
AlphaFold Q3UI43
Predicted Effect probably benign
Transcript: ENSMUST00000002473
AA Change: M263K

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000002473
Gene: ENSMUSG00000031820
AA Change: M263K

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 321 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119976
SMART Domains Protein: ENSMUSP00000113162
Gene: ENSMUSG00000046295

DomainStartEndE-ValueType
ANK 6 35 7.52e2 SMART
ANK 39 71 4.01e0 SMART
ANK 75 104 2.37e-2 SMART
ANK 108 139 1.99e2 SMART
low complexity region 177 193 N/A INTRINSIC
Pfam:LEM 282 319 4.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120725
SMART Domains Protein: ENSMUSP00000112797
Gene: ENSMUSG00000046295

DomainStartEndE-ValueType
ANK 6 35 7.52e2 SMART
ANK 39 71 4.01e0 SMART
ANK 75 104 2.37e-2 SMART
ANK 108 139 1.99e2 SMART
low complexity region 157 173 N/A INTRINSIC
Pfam:LEM 261 300 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212383
Predicted Effect probably benign
Transcript: ENSMUST00000212769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213093
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,509,802 T1128A probably benign Het
Apol11a A T 15: 77,516,990 K226* probably null Het
Atp4a A G 7: 30,712,474 M45V probably benign Het
Capn11 GACA GA 17: 45,633,097 probably null Het
Ccdc190 C A 1: 169,930,109 L46I possibly damaging Het
Cep131 C T 11: 120,068,057 R717H probably damaging Het
Cpt1c A G 7: 44,959,588 F770L probably benign Het
Dhx30 A T 9: 110,085,856 probably null Het
Dido1 G A 2: 180,675,029 Q662* probably null Het
Dip2a T C 10: 76,280,759 E910G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fmo3 T A 1: 162,968,731 I91F probably benign Het
Gdap1 A C 1: 17,159,994 D217A possibly damaging Het
Grm1 T C 10: 10,719,587 S766G possibly damaging Het
Kat8 T A 7: 127,915,538 I123N possibly damaging Het
Kcnt2 C A 1: 140,513,025 S23* probably null Het
Krt73 G A 15: 101,795,809 T432I probably damaging Het
Lgals9 T A 11: 78,966,083 I223L probably benign Het
Mpo T A 11: 87,802,681 N48K probably benign Het
Myo9a T G 9: 59,824,242 H632Q probably damaging Het
Olfr1386 C A 11: 49,470,216 Q22K probably benign Het
Olfr1412 A G 1: 92,588,921 N197S probably benign Het
Prelid2 A G 18: 41,951,144 F11S possibly damaging Het
Setd1a G T 7: 127,778,524 V57L probably damaging Het
Sgip1 A G 4: 102,966,234 D704G probably damaging Het
Spryd3 T C 15: 102,118,102 E378G probably benign Het
Stk17b A T 1: 53,771,611 Y112N probably damaging Het
Syndig1 A T 2: 149,899,891 K132N probably damaging Het
Tcf20 C T 15: 82,854,199 R1017Q possibly damaging Het
Tenm3 T A 8: 48,276,861 D1370V probably damaging Het
Tnrc6a C T 7: 123,169,911 T308I probably damaging Het
Ttc29 T C 8: 78,333,645 V398A probably damaging Het
Ubr4 A G 4: 139,428,517 T2218A probably benign Het
Other mutations in Babam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Babam1 APN 8 71398406 missense probably damaging 1.00
IGL03267:Babam1 APN 8 71403064 critical splice donor site probably null
I2288:Babam1 UTSW 8 71397823 missense probably damaging 1.00
R0270:Babam1 UTSW 8 71398406 missense probably damaging 1.00
R1532:Babam1 UTSW 8 71399633 missense possibly damaging 0.54
R1559:Babam1 UTSW 8 71397780 missense probably damaging 0.99
R1740:Babam1 UTSW 8 71403019 missense probably damaging 0.99
R2143:Babam1 UTSW 8 71398440 missense probably damaging 1.00
R2342:Babam1 UTSW 8 71402871 missense probably benign 0.42
R4639:Babam1 UTSW 8 71404307 missense probably damaging 1.00
R4935:Babam1 UTSW 8 71399802 missense probably benign 0.33
R4965:Babam1 UTSW 8 71404388 missense possibly damaging 0.90
R5192:Babam1 UTSW 8 71404253 missense probably damaging 1.00
R5836:Babam1 UTSW 8 71403043 missense probably benign 0.01
R6340:Babam1 UTSW 8 71402805 missense probably damaging 1.00
R7356:Babam1 UTSW 8 71399564 missense probably benign 0.01
R7967:Babam1 UTSW 8 71404355 missense probably damaging 1.00
R8310:Babam1 UTSW 8 71397985 missense possibly damaging 0.95
R9301:Babam1 UTSW 8 71403040 missense possibly damaging 0.89
Z1177:Babam1 UTSW 8 71399563 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACTGAGCCCATGAAGGTGAG -3'
(R):5'- GGATACAGCTGGGGAATGTC -3'

Sequencing Primer
(F):5'- CCATGAAGGTGAGCCTGG -3'
(R):5'- TACAGCTGGGGAATGTCAGGAATAG -3'
Posted On 2016-03-17