Mutagenetix > Incidental Mutation

Incidental Mutation 'R4892:Grm1'

377351

Institutional Source

Beutler Lab

Gene Symbol

Grm1

Ensembl Gene

ENSMUSG00000019828

Gene Name

glutamate receptor, metabotropic 1

Synonyms

Grm1, Gprc1a, mGluR1, nmf373, rcw, 4930455H15Rik

MMRRC Submission

042497-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.305) question?

Stock #

R4892 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10686059-11082356 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 10719587 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 766 (S766G)

Ref Sequence

ENSEMBL: ENSMUSP00000101190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044306] [ENSMUST00000105560] [ENSMUST00000105561]

AlphaFold

P97772

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044306
AA Change: S766G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000037255
Gene: ENSMUSG00000019828
AA Change: S766G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	77	485	1.1e-94	PFAM
Pfam:Peripla_BP_6	151	340	1.4e-10	PFAM
Pfam:NCD3G	521	571	5.5e-16	PFAM
Pfam:7tm_3	604	837	2.4e-55	PFAM
low complexity region	969	975	N/A	INTRINSIC
low complexity region	983	993	N/A	INTRINSIC
low complexity region	1013	1033	N/A	INTRINSIC
low complexity region	1071	1088	N/A	INTRINSIC
low complexity region	1093	1109	N/A	INTRINSIC
low complexity region	1126	1136	N/A	INTRINSIC
GluR_Homer-bdg	1149	1199	6.85e-27	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105560
AA Change: S766G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101189
Gene: ENSMUSG00000019828
AA Change: S766G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	77	485	2e-92	PFAM
Pfam:Peripla_BP_6	152	347	2.7e-12	PFAM
Pfam:NCD3G	520	571	2.7e-19	PFAM
Pfam:7tm_3	602	838	3.2e-73	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105561
AA Change: S766G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101190
Gene: ENSMUSG00000019828
AA Change: S766G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	77	485	2e-92	PFAM
Pfam:Peripla_BP_6	152	347	2.7e-12	PFAM
Pfam:NCD3G	520	571	2.7e-19	PFAM
Pfam:7tm_3	602	838	3.2e-73	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155772

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metabotropic glutamate receptor that functions by activating phospholipase C. L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The canonical alpha isoform of the encoded protein is a disulfide-linked homodimer whose activity is mediated by a G-protein-coupled phosphatidylinositol-calcium second messenger system. This gene may be associated with many disease states, including schizophrenia, bipolar disorder, depression, and breast cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for null mutations show impairements in motor coordination, spatial learning, hippocampal mossy fiber long-term potentiation, and cerebellar long-term depression. Homozygotes for a spontaneous mutation are small and exhibit ataxia, kyphoscoliosis, albuminuria and glomerular damage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	T	C	8: 86,509,802	T1128A	probably benign	Het
Apol11a	A	T	15: 77,516,990	K226*	probably null	Het
Atp4a	A	G	7: 30,712,474	M45V	probably benign	Het
Babam1	T	A	8: 71,403,052	M263K	probably benign	Het
Capn11	GACA	GA	17: 45,633,097		probably null	Het
Ccdc190	C	A	1: 169,930,109	L46I	possibly damaging	Het
Cep131	C	T	11: 120,068,057	R717H	probably damaging	Het
Cpt1c	A	G	7: 44,959,588	F770L	probably benign	Het
Dhx30	A	T	9: 110,085,856		probably null	Het
Dido1	G	A	2: 180,675,029	Q662*	probably null	Het
Dip2a	T	C	10: 76,280,759	E910G	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Fmo3	T	A	1: 162,968,731	I91F	probably benign	Het
Gdap1	A	C	1: 17,159,994	D217A	possibly damaging	Het
Kat8	T	A	7: 127,915,538	I123N	possibly damaging	Het
Kcnt2	C	A	1: 140,513,025	S23*	probably null	Het
Krt73	G	A	15: 101,795,809	T432I	probably damaging	Het
Lgals9	T	A	11: 78,966,083	I223L	probably benign	Het
Mpo	T	A	11: 87,802,681	N48K	probably benign	Het
Myo9a	T	G	9: 59,824,242	H632Q	probably damaging	Het
Olfr1386	C	A	11: 49,470,216	Q22K	probably benign	Het
Olfr1412	A	G	1: 92,588,921	N197S	probably benign	Het
Prelid2	A	G	18: 41,951,144	F11S	possibly damaging	Het
Setd1a	G	T	7: 127,778,524	V57L	probably damaging	Het
Sgip1	A	G	4: 102,966,234	D704G	probably damaging	Het
Spryd3	T	C	15: 102,118,102	E378G	probably benign	Het
Stk17b	A	T	1: 53,771,611	Y112N	probably damaging	Het
Syndig1	A	T	2: 149,899,891	K132N	probably damaging	Het
Tcf20	C	T	15: 82,854,199	R1017Q	possibly damaging	Het
Tenm3	T	A	8: 48,276,861	D1370V	probably damaging	Het
Tnrc6a	C	T	7: 123,169,911	T308I	probably damaging	Het
Ttc29	T	C	8: 78,333,645	V398A	probably damaging	Het
Ubr4	A	G	4: 139,428,517	T2218A	probably benign	Het

Other mutations in Grm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01371:Grm1	APN	10	10720039	missense	probably benign	0.01
IGL02078:Grm1	APN	10	10689610	missense	probably benign	0.02
IGL02156:Grm1	APN	10	10719976	missense	probably damaging	0.99
IGL02476:Grm1	APN	10	10689453	missense	probably benign	0.29
IGL02498:Grm1	APN	10	10719979	missense	probably damaging	1.00
IGL02621:Grm1	APN	10	10689011	nonsense	probably null
IGL03192:Grm1	APN	10	11079916	missense	possibly damaging	0.66
IGL03342:Grm1	APN	10	11079971	missense	probably benign	0.08
dewey	UTSW	10	10719595	missense	probably damaging	1.00
Dingus	UTSW	10	10719967	missense	probably benign	0.06
donald	UTSW	10	10741508	nonsense	probably null
jim	UTSW	10	10719805	missense	probably damaging	1.00
lightness	UTSW	10	11079958	missense	probably damaging	1.00
IGL02796:Grm1	UTSW	10	10689667	missense	probably benign
R0294:Grm1	UTSW	10	11080399	missense	probably damaging	1.00
R0525:Grm1	UTSW	10	10719209	splice site	probably benign
R0554:Grm1	UTSW	10	10719923	missense	probably benign	0.01
R1184:Grm1	UTSW	10	10720034	missense	probably benign	0.40
R1319:Grm1	UTSW	10	10689398	missense	probably benign	0.05
R1403:Grm1	UTSW	10	11080135	missense	probably benign	0.00
R1403:Grm1	UTSW	10	11080135	missense	probably benign	0.00
R1467:Grm1	UTSW	10	10719958	missense	probably damaging	1.00
R1467:Grm1	UTSW	10	10719958	missense	probably damaging	1.00
R1494:Grm1	UTSW	10	10689706	missense	probably benign	0.04
R1589:Grm1	UTSW	10	10719967	missense	probably benign	0.06
R1615:Grm1	UTSW	10	10741508	nonsense	probably null
R1720:Grm1	UTSW	10	10746794	splice site	probably null
R1738:Grm1	UTSW	10	10936419	missense	probably damaging	1.00
R1763:Grm1	UTSW	10	11079866	missense	possibly damaging	0.47
R1774:Grm1	UTSW	10	11079866	missense	possibly damaging	0.47
R2041:Grm1	UTSW	10	10746603	missense	probably damaging	0.98
R2092:Grm1	UTSW	10	10689225	missense	probably benign	0.00
R2198:Grm1	UTSW	10	10782776	missense	probably damaging	1.00
R2297:Grm1	UTSW	10	11080414	missense	probably benign	0.03
R2333:Grm1	UTSW	10	10719346	missense	probably damaging	0.98
R2333:Grm1	UTSW	10	10719619	missense	probably benign	0.31
R2914:Grm1	UTSW	10	11079857	missense	probably benign	0.07
R3105:Grm1	UTSW	10	11079857	missense	probably benign	0.07
R3106:Grm1	UTSW	10	11079857	missense	probably benign	0.07
R3705:Grm1	UTSW	10	10782729	missense	possibly damaging	0.95
R3931:Grm1	UTSW	10	10719878	missense	probably benign	0.44
R4810:Grm1	UTSW	10	10782694	missense	probably damaging	1.00
R4938:Grm1	UTSW	10	10936513	missense	probably damaging	1.00
R4947:Grm1	UTSW	10	10782633	missense	probably damaging	1.00
R4966:Grm1	UTSW	10	10719665	nonsense	probably null
R5152:Grm1	UTSW	10	11079875	missense	probably benign	0.13
R5283:Grm1	UTSW	10	10733192	missense	possibly damaging	0.70
R5317:Grm1	UTSW	10	10746699	missense	possibly damaging	0.77
R5374:Grm1	UTSW	10	11080442	missense	probably benign	0.14
R5428:Grm1	UTSW	10	10719563	missense	probably damaging	1.00
R5604:Grm1	UTSW	10	10746735	missense	probably damaging	1.00
R5894:Grm1	UTSW	10	11080255	missense	probably damaging	1.00
R5896:Grm1	UTSW	10	11080550	utr 5 prime	probably benign
R5899:Grm1	UTSW	10	10689348	missense	probably benign
R6032:Grm1	UTSW	10	10719805	missense	probably damaging	1.00
R6032:Grm1	UTSW	10	10719805	missense	probably damaging	1.00
R6139:Grm1	UTSW	10	10746331	intron	probably benign
R6144:Grm1	UTSW	10	11079896	missense	probably benign	0.08
R6208:Grm1	UTSW	10	10719946	missense	probably damaging	1.00
R6976:Grm1	UTSW	10	10689180	missense	probably benign	0.00
R7027:Grm1	UTSW	10	10719595	missense	probably damaging	1.00
R7079:Grm1	UTSW	10	11079958	missense	probably damaging	1.00
R7286:Grm1	UTSW	10	10689696	missense	probably benign	0.19
R7352:Grm1	UTSW	10	10719493	missense	probably damaging	1.00
R7484:Grm1	UTSW	10	10746659	missense	probably benign	0.06
R7838:Grm1	UTSW	10	11080352	missense	probably benign	0.02
R8108:Grm1	UTSW	10	10720132	missense	probably benign	0.01
R8379:Grm1	UTSW	10	10689135	missense	possibly damaging	0.86
R8498:Grm1	UTSW	10	11079861	nonsense	probably null
R8712:Grm1	UTSW	10	10689552	missense	probably benign	0.34
R8856:Grm1	UTSW	10	10719348	missense	probably damaging	1.00
R8904:Grm1	UTSW	10	10719537	missense	probably damaging	1.00
R9043:Grm1	UTSW	10	10689312	nonsense	probably null
R9477:Grm1	UTSW	10	10719661	missense	probably benign	0.15
X0002:Grm1	UTSW	10	10936513	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACATCTTGGGAGTGAACATGC -3'
(R):5'- CTTGGGCCCAAGTGATCATAG -3'

Sequencing Primer
(F):5'- TGAACATGCAGCCCAGG -3'
(R):5'- AGCCTCCATTCTGATTAGTGTACAG -3'

Posted On

2016-03-17