Mutagenetix > Incidental Mutations

Incidental Mutation 'R4892:Dip2a'

377352

Institutional Source

Beutler Lab

Gene Symbol

Dip2a

Ensembl Gene

ENSMUSG00000020231

Gene Name

disco interacting protein 2 homolog A

Synonyms

Kiaa0184-hp, 4931420H10Rik, Dip2

MMRRC Submission

042497-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4892 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76259429-76345291 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76280759 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 910 (E910G)

Ref Sequence

ENSEMBL: ENSMUSP00000043710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036033] [ENSMUST00000105417] [ENSMUST00000160048] [ENSMUST00000160442]

AlphaFold

Q8BWT5

Predicted Effect

probably benign
Transcript: ENSMUST00000036033
AA Change: E910G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000043710
Gene: ENSMUSG00000020231
AA Change: E910G

Domain	Start	End	E-Value	Type
DMAP_binding	9	122	2.55e-35	SMART
low complexity region	173	208	N/A	INTRINSIC
low complexity region	281	293	N/A	INTRINSIC
Pfam:AMP-binding	330	806	4.3e-26	PFAM
Pfam:AMP-binding	982	1456	1.4e-52	PFAM
low complexity region	1487	1498	N/A	INTRINSIC
low complexity region	1511	1532	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105417
AA Change: E910G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000101057
Gene: ENSMUSG00000020231
AA Change: E910G

Domain	Start	End	E-Value	Type
DMAP_binding	9	122	2.55e-35	SMART
low complexity region	173	208	N/A	INTRINSIC
low complexity region	281	293	N/A	INTRINSIC
Pfam:AMP-binding	330	806	6.6e-28	PFAM
Pfam:AMP-binding	992	1466	7.3e-65	PFAM
low complexity region	1497	1508	N/A	INTRINSIC
low complexity region	1521	1542	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159807

Predicted Effect

probably benign
Transcript: ENSMUST00000160048
AA Change: E871G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000125184
Gene: ENSMUSG00000020231
AA Change: E871G

Domain	Start	End	E-Value	Type
DMAP_binding	9	83	7.94e-23	SMART
low complexity region	134	169	N/A	INTRINSIC
low complexity region	242	254	N/A	INTRINSIC
Pfam:AMP-binding	291	767	5.3e-26	PFAM
Pfam:AMP-binding	943	1417	1.7e-52	PFAM
low complexity region	1448	1459	N/A	INTRINSIC
low complexity region	1472	1493	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160442

SMART Domains

Protein: ENSMUSP00000125744
Gene: ENSMUSG00000020231

Domain	Start	End	E-Value	Type
low complexity region	37	48	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be involved in axon patterning in the central nervous system. This gene is not highly expressed. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	T	C	8: 86,509,802	T1128A	probably benign	Het
Apol11a	A	T	15: 77,516,990	K226*	probably null	Het
Atp4a	A	G	7: 30,712,474	M45V	probably benign	Het
Babam1	T	A	8: 71,403,052	M263K	probably benign	Het
Capn11	GACA	GA	17: 45,633,097		probably null	Het
Ccdc190	C	A	1: 169,930,109	L46I	possibly damaging	Het
Cep131	C	T	11: 120,068,057	R717H	probably damaging	Het
Cpt1c	A	G	7: 44,959,588	F770L	probably benign	Het
Dhx30	A	T	9: 110,085,856		probably null	Het
Dido1	G	A	2: 180,675,029	Q662*	probably null	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Fmo3	T	A	1: 162,968,731	I91F	probably benign	Het
Gdap1	A	C	1: 17,159,994	D217A	possibly damaging	Het
Grm1	T	C	10: 10,719,587	S766G	possibly damaging	Het
Kat8	T	A	7: 127,915,538	I123N	possibly damaging	Het
Kcnt2	C	A	1: 140,513,025	S23*	probably null	Het
Krt73	G	A	15: 101,795,809	T432I	probably damaging	Het
Lgals9	T	A	11: 78,966,083	I223L	probably benign	Het
Mpo	T	A	11: 87,802,681	N48K	probably benign	Het
Myo9a	T	G	9: 59,824,242	H632Q	probably damaging	Het
Olfr1386	C	A	11: 49,470,216	Q22K	probably benign	Het
Olfr1412	A	G	1: 92,588,921	N197S	probably benign	Het
Prelid2	A	G	18: 41,951,144	F11S	possibly damaging	Het
Setd1a	G	T	7: 127,778,524	V57L	probably damaging	Het
Sgip1	A	G	4: 102,966,234	D704G	probably damaging	Het
Spryd3	T	C	15: 102,118,102	E378G	probably benign	Het
Stk17b	A	T	1: 53,771,611	Y112N	probably damaging	Het
Syndig1	A	T	2: 149,899,891	K132N	probably damaging	Het
Tcf20	C	T	15: 82,854,199	R1017Q	possibly damaging	Het
Tenm3	T	A	8: 48,276,861	D1370V	probably damaging	Het
Tnrc6a	C	T	7: 123,169,911	T308I	probably damaging	Het
Ttc29	T	C	8: 78,333,645	V398A	probably damaging	Het
Ubr4	A	G	4: 139,428,517	T2218A	probably benign	Het

Other mutations in Dip2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Dip2a	APN	10	76313236	missense	probably benign
IGL00849:Dip2a	APN	10	76292318	missense	probably damaging	0.99
IGL01685:Dip2a	APN	10	76327749	missense	probably damaging	1.00
IGL01825:Dip2a	APN	10	76272680	nonsense	probably null
IGL02343:Dip2a	APN	10	76319478	missense	probably benign	0.00
IGL02437:Dip2a	APN	10	76298267	missense	probably benign	0.09
IGL02981:Dip2a	APN	10	76276421	missense	possibly damaging	0.84
IGL03122:Dip2a	APN	10	76275046	missense	probably benign	0.00
IGL03261:Dip2a	APN	10	76305148	missense	possibly damaging	0.80
R0369:Dip2a	UTSW	10	76298787	missense	probably damaging	1.00
R0522:Dip2a	UTSW	10	76321531	missense	probably benign	0.03
R0962:Dip2a	UTSW	10	76292432	unclassified	probably benign
R1164:Dip2a	UTSW	10	76276397	missense	possibly damaging	0.72
R1309:Dip2a	UTSW	10	76279776	missense	probably damaging	1.00
R1426:Dip2a	UTSW	10	76279820	unclassified	probably benign
R1636:Dip2a	UTSW	10	76321578	missense	probably benign	0.01
R1823:Dip2a	UTSW	10	76278502	nonsense	probably null
R1830:Dip2a	UTSW	10	76317963	missense	probably damaging	1.00
R1876:Dip2a	UTSW	10	76318091	missense	probably damaging	1.00
R2284:Dip2a	UTSW	10	76313193	missense	probably benign	0.01
R2369:Dip2a	UTSW	10	76313196	missense	probably benign
R4050:Dip2a	UTSW	10	76278607	missense	probably damaging	1.00
R4089:Dip2a	UTSW	10	76278489	splice site	probably null
R4231:Dip2a	UTSW	10	76319470	missense	probably damaging	1.00
R4715:Dip2a	UTSW	10	76296406	missense	probably benign	0.34
R4752:Dip2a	UTSW	10	76276657	missense	probably damaging	1.00
R4846:Dip2a	UTSW	10	76321493	missense	probably damaging	1.00
R4849:Dip2a	UTSW	10	76294533	missense	probably damaging	1.00
R4998:Dip2a	UTSW	10	76319556	nonsense	probably null
R5068:Dip2a	UTSW	10	76318043	missense	possibly damaging	0.82
R5141:Dip2a	UTSW	10	76270453	missense	probably damaging	1.00
R5253:Dip2a	UTSW	10	76299997	missense	probably damaging	1.00
R5304:Dip2a	UTSW	10	76294523	missense	possibly damaging	0.67
R5324:Dip2a	UTSW	10	76296393	missense	probably damaging	1.00
R5369:Dip2a	UTSW	10	76292360	missense	probably damaging	1.00
R6272:Dip2a	UTSW	10	76286407	makesense	probably null
R6884:Dip2a	UTSW	10	76272532	critical splice donor site	probably null
R7143:Dip2a	UTSW	10	76297791	missense	probably damaging	1.00
R7247:Dip2a	UTSW	10	76272532	critical splice donor site	probably null
R7252:Dip2a	UTSW	10	76273202	missense	not run
R7327:Dip2a	UTSW	10	76272562	missense	probably benign	0.41
R7334:Dip2a	UTSW	10	76274246	missense	possibly damaging	0.91
R7349:Dip2a	UTSW	10	76285592	missense	probably damaging	1.00
R7360:Dip2a	UTSW	10	76278560	missense	probably damaging	1.00
R7513:Dip2a	UTSW	10	76313235	missense	probably benign
R7793:Dip2a	UTSW	10	76278583	missense	probably benign	0.06
R7794:Dip2a	UTSW	10	76276625	missense	probably damaging	1.00
R7819:Dip2a	UTSW	10	76291028	missense	probably benign	0.06
R8079:Dip2a	UTSW	10	76287321	missense	probably benign
R8280:Dip2a	UTSW	10	76264776	missense	possibly damaging	0.75
R8281:Dip2a	UTSW	10	76276604	missense	probably damaging	1.00
R8286:Dip2a	UTSW	10	76286463	missense	probably benign
R8350:Dip2a	UTSW	10	76264856	missense	probably damaging	1.00
R8450:Dip2a	UTSW	10	76264856	missense	probably damaging	1.00
R8525:Dip2a	UTSW	10	76274281	critical splice acceptor site	probably null
R8824:Dip2a	UTSW	10	76278486	critical splice donor site	probably null
R8897:Dip2a	UTSW	10	76274264	missense	probably benign	0.22
R9039:Dip2a	UTSW	10	76327719	missense	probably benign	0.00
R9286:Dip2a	UTSW	10	76302262	missense	probably benign	0.05
Z1088:Dip2a	UTSW	10	76285628	missense	probably benign	0.06
Z1176:Dip2a	UTSW	10	76266323	missense	possibly damaging	0.94
Z1176:Dip2a	UTSW	10	76280820	missense	probably damaging	0.97
Z1177:Dip2a	UTSW	10	76266322	missense	possibly damaging	0.51
Z1177:Dip2a	UTSW	10	76296400	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTACTGACTCCTGCAAGATC -3'
(R):5'- GGAGTTGTGTCAGAGGTCAC -3'

Sequencing Primer
(F):5'- GTACTGACTCCTGCAAGATCCAATG -3'
(R):5'- GTTGTGTCAGAGGTCACCCACTC -3'

Posted On

2016-03-17