Incidental Mutation 'R4892:Olfr1386'
ID 377353
Institutional Source Beutler Lab
Gene Symbol Olfr1386
Ensembl Gene ENSMUSG00000108167
Gene Name olfactory receptor 1386
Synonyms GA_x6K02T2QP88-5964781-5963852, MOR256-50
MMRRC Submission 042497-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R4892 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 49465046-49471715 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 49470216 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 22 (Q22K)
Ref Sequence ENSEMBL: ENSMUSP00000150448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071905] [ENSMUST00000204518] [ENSMUST00000213674]
AlphaFold Q7TQT0
Predicted Effect probably benign
Transcript: ENSMUST00000071905
AA Change: Q22K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000071801
Gene: ENSMUSG00000108167
AA Change: Q22K

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 227 1.2e-5 PFAM
Pfam:7tm_1 41 289 7.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204518
AA Change: Q22K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000145320
Gene: ENSMUSG00000108167
AA Change: Q22K

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 227 1.2e-5 PFAM
Pfam:7tm_1 41 289 7.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213674
AA Change: Q22K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,509,802 T1128A probably benign Het
Apol11a A T 15: 77,516,990 K226* probably null Het
Atp4a A G 7: 30,712,474 M45V probably benign Het
Babam1 T A 8: 71,403,052 M263K probably benign Het
Capn11 GACA GA 17: 45,633,097 probably null Het
Ccdc190 C A 1: 169,930,109 L46I possibly damaging Het
Cep131 C T 11: 120,068,057 R717H probably damaging Het
Cpt1c A G 7: 44,959,588 F770L probably benign Het
Dhx30 A T 9: 110,085,856 probably null Het
Dido1 G A 2: 180,675,029 Q662* probably null Het
Dip2a T C 10: 76,280,759 E910G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fmo3 T A 1: 162,968,731 I91F probably benign Het
Gdap1 A C 1: 17,159,994 D217A possibly damaging Het
Grm1 T C 10: 10,719,587 S766G possibly damaging Het
Kat8 T A 7: 127,915,538 I123N possibly damaging Het
Kcnt2 C A 1: 140,513,025 S23* probably null Het
Krt73 G A 15: 101,795,809 T432I probably damaging Het
Lgals9 T A 11: 78,966,083 I223L probably benign Het
Mpo T A 11: 87,802,681 N48K probably benign Het
Myo9a T G 9: 59,824,242 H632Q probably damaging Het
Olfr1412 A G 1: 92,588,921 N197S probably benign Het
Prelid2 A G 18: 41,951,144 F11S possibly damaging Het
Setd1a G T 7: 127,778,524 V57L probably damaging Het
Sgip1 A G 4: 102,966,234 D704G probably damaging Het
Spryd3 T C 15: 102,118,102 E378G probably benign Het
Stk17b A T 1: 53,771,611 Y112N probably damaging Het
Syndig1 A T 2: 149,899,891 K132N probably damaging Het
Tcf20 C T 15: 82,854,199 R1017Q possibly damaging Het
Tenm3 T A 8: 48,276,861 D1370V probably damaging Het
Tnrc6a C T 7: 123,169,911 T308I probably damaging Het
Ttc29 T C 8: 78,333,645 V398A probably damaging Het
Ubr4 A G 4: 139,428,517 T2218A probably benign Het
Other mutations in Olfr1386
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Olfr1386 APN 11 49471053 missense probably benign 0.00
IGL02698:Olfr1386 APN 11 49470863 missense probably benign 0.02
IGL02727:Olfr1386 APN 11 49471066 missense probably benign 0.04
R0826:Olfr1386 UTSW 11 49470331 missense probably damaging 1.00
R1512:Olfr1386 UTSW 11 49470459 missense probably benign 0.00
R1822:Olfr1386 UTSW 11 49470968 missense probably benign 0.03
R1942:Olfr1386 UTSW 11 49470154 start codon destroyed probably null 0.98
R2282:Olfr1386 UTSW 11 49470643 missense probably damaging 0.96
R4646:Olfr1386 UTSW 11 49470624 missense probably benign 0.00
R4762:Olfr1386 UTSW 11 49470285 missense probably damaging 1.00
R4968:Olfr1386 UTSW 11 49470531 missense probably damaging 1.00
R6882:Olfr1386 UTSW 11 49470463 missense probably benign
R7107:Olfr1386 UTSW 11 49470434 nonsense probably null
R7300:Olfr1386 UTSW 11 49470646 missense probably benign 0.00
R7308:Olfr1386 UTSW 11 49469927 start gained probably benign
R8876:Olfr1386 UTSW 11 49470559 missense probably damaging 0.97
R8901:Olfr1386 UTSW 11 49470208 missense probably damaging 1.00
R9048:Olfr1386 UTSW 11 49471053 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTCAACAGATGTAGCTGAGCAG -3'
(R):5'- GGTCCTGTCTTGTCCATAGAGG -3'

Sequencing Primer
(F):5'- CTGAGCAGCAACATGGAAATC -3'
(R):5'- CTTGTCCATAGAGGTTGATGAGGAGC -3'
Posted On 2016-03-17