Incidental Mutation 'R4892:Lgals9'
ID 377354
Institutional Source Beutler Lab
Gene Symbol Lgals9
Ensembl Gene ENSMUSG00000001123
Gene Name lectin, galactose binding, soluble 9
Synonyms Lgals5, galectin-9, LGALS35, gal-9
MMRRC Submission 042497-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R4892 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 78962974-78984946 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78966083 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 223 (I223L)
Ref Sequence ENSEMBL: ENSMUSP00000103904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073001] [ENSMUST00000108268] [ENSMUST00000108269]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000073001
AA Change: I222L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072764
Gene: ENSMUSG00000001123
AA Change: I222L

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 222 352 5.38e-60 SMART
Gal-bind_lectin 228 352 1.33e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108268
AA Change: I192L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103903
Gene: ENSMUSG00000001123
AA Change: I192L

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 192 322 5.38e-60 SMART
Gal-bind_lectin 198 322 1.33e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108269
AA Change: I223L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103904
Gene: ENSMUSG00000001123
AA Change: I223L

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 223 353 5.38e-60 SMART
Gal-bind_lectin 229 353 1.33e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140073
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was initially thought to represent a pseudogene of galectin 9; however, this transcript has good exon-intron structure and encodes a predicted protein of the same size as and highly similar to galectin 9. This gene is one of two similar loci on chromosome 17p similar to galectin 9 and now thought to be protein-encoding. This gene is the more centromeric gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased susceptibility to collagen-induced arthritis, increased T-helper 1 cells and decreased regulatory T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,509,802 T1128A probably benign Het
Apol11a A T 15: 77,516,990 K226* probably null Het
Atp4a A G 7: 30,712,474 M45V probably benign Het
Babam1 T A 8: 71,403,052 M263K probably benign Het
Capn11 GACA GA 17: 45,633,097 probably null Het
Ccdc190 C A 1: 169,930,109 L46I possibly damaging Het
Cep131 C T 11: 120,068,057 R717H probably damaging Het
Cpt1c A G 7: 44,959,588 F770L probably benign Het
Dhx30 A T 9: 110,085,856 probably null Het
Dido1 G A 2: 180,675,029 Q662* probably null Het
Dip2a T C 10: 76,280,759 E910G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fmo3 T A 1: 162,968,731 I91F probably benign Het
Gdap1 A C 1: 17,159,994 D217A possibly damaging Het
Grm1 T C 10: 10,719,587 S766G possibly damaging Het
Kat8 T A 7: 127,915,538 I123N possibly damaging Het
Kcnt2 C A 1: 140,513,025 S23* probably null Het
Krt73 G A 15: 101,795,809 T432I probably damaging Het
Mpo T A 11: 87,802,681 N48K probably benign Het
Myo9a T G 9: 59,824,242 H632Q probably damaging Het
Olfr1386 C A 11: 49,470,216 Q22K probably benign Het
Olfr1412 A G 1: 92,588,921 N197S probably benign Het
Prelid2 A G 18: 41,951,144 F11S possibly damaging Het
Setd1a G T 7: 127,778,524 V57L probably damaging Het
Sgip1 A G 4: 102,966,234 D704G probably damaging Het
Spryd3 T C 15: 102,118,102 E378G probably benign Het
Stk17b A T 1: 53,771,611 Y112N probably damaging Het
Syndig1 A T 2: 149,899,891 K132N probably damaging Het
Tcf20 C T 15: 82,854,199 R1017Q possibly damaging Het
Tenm3 T A 8: 48,276,861 D1370V probably damaging Het
Tnrc6a C T 7: 123,169,911 T308I probably damaging Het
Ttc29 T C 8: 78,333,645 V398A probably damaging Het
Ubr4 A G 4: 139,428,517 T2218A probably benign Het
Other mutations in Lgals9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Lgals9 APN 11 78973151 missense probably damaging 1.00
IGL01415:Lgals9 APN 11 78973151 missense probably damaging 1.00
IGL02194:Lgals9 APN 11 78966920 critical splice acceptor site probably null
IGL02390:Lgals9 APN 11 78963535 missense probably damaging 1.00
IGL02987:Lgals9 APN 11 78967477 missense possibly damaging 0.93
IGL03288:Lgals9 APN 11 78984800 missense probably benign 0.01
IGL03388:Lgals9 APN 11 78963421 missense probably damaging 0.99
R0057:Lgals9 UTSW 11 78971436 splice site probably benign
R0143:Lgals9 UTSW 11 78963535 missense probably damaging 1.00
R0325:Lgals9 UTSW 11 78963448 missense probably damaging 0.99
R0522:Lgals9 UTSW 11 78965812 missense possibly damaging 0.95
R0542:Lgals9 UTSW 11 78969720 missense possibly damaging 0.68
R0673:Lgals9 UTSW 11 78965853 missense probably damaging 1.00
R1312:Lgals9 UTSW 11 78976617 nonsense probably null
R2000:Lgals9 UTSW 11 78973170 missense probably benign 0.01
R4083:Lgals9 UTSW 11 78969763 missense possibly damaging 0.63
R4084:Lgals9 UTSW 11 78969763 missense possibly damaging 0.63
R4157:Lgals9 UTSW 11 78973107 missense possibly damaging 0.88
R4204:Lgals9 UTSW 11 78969816 splice site probably benign
R5650:Lgals9 UTSW 11 78973154 missense probably damaging 0.97
R6155:Lgals9 UTSW 11 78963505 missense probably benign 0.16
R6166:Lgals9 UTSW 11 78971358 missense probably benign 0.14
R6405:Lgals9 UTSW 11 78971385 missense probably benign 0.42
R6853:Lgals9 UTSW 11 78966006 missense probably benign 0.16
R8035:Lgals9 UTSW 11 78963476 nonsense probably null
R8862:Lgals9 UTSW 11 78969890 intron probably benign
Predicted Primers PCR Primer
(F):5'- ATGGACAGTTCACAGAGACCC -3'
(R):5'- GAAACACAGGAAGGGTTCTTTTG -3'

Sequencing Primer
(F):5'- CAGAGACCCCGTTTAGTTACTGAG -3'
(R):5'- AACACAGGAAGGGTTCTTTTGTTTTG -3'
Posted On 2016-03-17