Mutagenetix > Incidental Mutations

Incidental Mutation 'R4892:Mpo'

377355

Institutional Source

Beutler Lab

Gene Symbol

Mpo

Ensembl Gene

ENSMUSG00000009350

Gene Name

myeloperoxidase

Synonyms

MMRRC Submission

042497-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4892 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87793581-87804413 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 87802681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 48 (N48K)

Ref Sequence

ENSEMBL: ENSMUSP00000128484 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020779] [ENSMUST00000103177] [ENSMUST00000107930] [ENSMUST00000121303] [ENSMUST00000146650]

AlphaFold

P11247

Predicted Effect

probably benign
Transcript: ENSMUST00000020779
AA Change: N628K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000020779
Gene: ENSMUSG00000009350
AA Change: N628K

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:An_peroxidase	147	692	4.2e-183	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000103177

SMART Domains

Protein: ENSMUSP00000099466
Gene: ENSMUSG00000009356

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:An_peroxidase	136	682	1.8e-180	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107930

SMART Domains

Protein: ENSMUSP00000103563
Gene: ENSMUSG00000009350

Domain	Start	End	E-Value	Type
SCOP:g1cxp.1	82	99	1e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000121303
AA Change: N628K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000112837
Gene: ENSMUSG00000009350
AA Change: N628K

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:An_peroxidase	147	692	4.2e-183	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130442

Predicted Effect

probably benign
Transcript: ENSMUST00000146650
AA Change: N48K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000128484
Gene: ENSMUSG00000009350
AA Change: N48K

Domain	Start	End	E-Value	Type
Pfam:An_peroxidase	1	112	2.4e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167903

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myeloperoxidase (MPO) is a heme protein synthesized during myeloid differentiation that constitutes the major component of neutrophil azurophilic granules. Produced as a single chain precursor, myeloperoxidase is subsequently cleaved into a light and heavy chain. The mature myeloperoxidase is a tetramer composed of 2 light chains and 2 heavy chains. This enzyme produces hypohalous acids central to the microbicidal activity of neutrophils. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene causes neutrophil dysfunction and decreased resistance to fungal infection with Candida, and may lead to enhanced atherosclerosis, reduced neutrophil-mediated lysis of muscle cells, decreased resistance to EAE, and altered asbestos-induced lung inflammation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	T	C	8: 86,509,802	T1128A	probably benign	Het
Apol11a	A	T	15: 77,516,990	K226*	probably null	Het
Atp4a	A	G	7: 30,712,474	M45V	probably benign	Het
Babam1	T	A	8: 71,403,052	M263K	probably benign	Het
Capn11	GACA	GA	17: 45,633,097		probably null	Het
Ccdc190	C	A	1: 169,930,109	L46I	possibly damaging	Het
Cep131	C	T	11: 120,068,057	R717H	probably damaging	Het
Cpt1c	A	G	7: 44,959,588	F770L	probably benign	Het
Dhx30	A	T	9: 110,085,856		probably null	Het
Dido1	G	A	2: 180,675,029	Q662*	probably null	Het
Dip2a	T	C	10: 76,280,759	E910G	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Fmo3	T	A	1: 162,968,731	I91F	probably benign	Het
Gdap1	A	C	1: 17,159,994	D217A	possibly damaging	Het
Grm1	T	C	10: 10,719,587	S766G	possibly damaging	Het
Kat8	T	A	7: 127,915,538	I123N	possibly damaging	Het
Kcnt2	C	A	1: 140,513,025	S23*	probably null	Het
Krt73	G	A	15: 101,795,809	T432I	probably damaging	Het
Lgals9	T	A	11: 78,966,083	I223L	probably benign	Het
Myo9a	T	G	9: 59,824,242	H632Q	probably damaging	Het
Olfr1386	C	A	11: 49,470,216	Q22K	probably benign	Het
Olfr1412	A	G	1: 92,588,921	N197S	probably benign	Het
Prelid2	A	G	18: 41,951,144	F11S	possibly damaging	Het
Setd1a	G	T	7: 127,778,524	V57L	probably damaging	Het
Sgip1	A	G	4: 102,966,234	D704G	probably damaging	Het
Spryd3	T	C	15: 102,118,102	E378G	probably benign	Het
Stk17b	A	T	1: 53,771,611	Y112N	probably damaging	Het
Syndig1	A	T	2: 149,899,891	K132N	probably damaging	Het
Tcf20	C	T	15: 82,854,199	R1017Q	possibly damaging	Het
Tenm3	T	A	8: 48,276,861	D1370V	probably damaging	Het
Tnrc6a	C	T	7: 123,169,911	T308I	probably damaging	Het
Ttc29	T	C	8: 78,333,645	V398A	probably damaging	Het
Ubr4	A	G	4: 139,428,517	T2218A	probably benign	Het

Other mutations in Mpo

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Mpo	APN	11	87802617	missense	probably benign
IGL00668:Mpo	APN	11	87797334	missense	probably benign	0.01
IGL01016:Mpo	APN	11	87797610	splice site	probably null
IGL01517:Mpo	APN	11	87795821	missense	possibly damaging	0.83
IGL01530:Mpo	APN	11	87801191	missense	probably benign	0.00
IGL02123:Mpo	APN	11	87794795	missense	probably benign	0.05
BB001:Mpo	UTSW	11	87794840	missense	probably damaging	1.00
BB011:Mpo	UTSW	11	87794840	missense	probably damaging	1.00
R0091:Mpo	UTSW	11	87801610	missense	probably benign	0.06
R0458:Mpo	UTSW	11	87796297	missense	probably benign	0.35
R0506:Mpo	UTSW	11	87803504	missense	probably benign	0.00
R0574:Mpo	UTSW	11	87796076	missense	probably damaging	0.99
R0850:Mpo	UTSW	11	87797502	missense	probably damaging	1.00
R1488:Mpo	UTSW	11	87797430	missense	probably damaging	1.00
R1753:Mpo	UTSW	11	87795881	missense	probably benign	0.06
R1785:Mpo	UTSW	11	87797361	missense	possibly damaging	0.90
R1891:Mpo	UTSW	11	87801280	nonsense	probably null
R1989:Mpo	UTSW	11	87803472	missense	probably damaging	1.00
R2107:Mpo	UTSW	11	87796075	missense	probably damaging	1.00
R2108:Mpo	UTSW	11	87796075	missense	probably damaging	1.00
R2130:Mpo	UTSW	11	87797361	missense	possibly damaging	0.90
R2132:Mpo	UTSW	11	87797361	missense	possibly damaging	0.90
R3930:Mpo	UTSW	11	87801040	missense	probably damaging	1.00
R3931:Mpo	UTSW	11	87801040	missense	probably damaging	1.00
R3941:Mpo	UTSW	11	87797349	missense	probably benign	0.02
R4323:Mpo	UTSW	11	87796039	missense	probably damaging	1.00
R4857:Mpo	UTSW	11	87796281	missense	probably benign
R5224:Mpo	UTSW	11	87796457	unclassified	probably benign
R5250:Mpo	UTSW	11	87803433	missense	probably benign	0.03
R5373:Mpo	UTSW	11	87803611	critical splice donor site	probably null
R5374:Mpo	UTSW	11	87803611	critical splice donor site	probably null
R5408:Mpo	UTSW	11	87801025	splice site	probably null
R5708:Mpo	UTSW	11	87801755	splice site	probably null
R6354:Mpo	UTSW	11	87797346	missense	possibly damaging	0.89
R6598:Mpo	UTSW	11	87799972	missense	probably benign	0.43
R6713:Mpo	UTSW	11	87795368	missense	probably damaging	1.00
R7053:Mpo	UTSW	11	87803510	missense	probably damaging	0.99
R7395:Mpo	UTSW	11	87801124	missense	probably damaging	1.00
R7573:Mpo	UTSW	11	87797577	missense	probably benign	0.01
R7924:Mpo	UTSW	11	87794840	missense	probably damaging	1.00
R8152:Mpo	UTSW	11	87801649	missense	probably benign
R8285:Mpo	UTSW	11	87797567	missense	probably benign	0.05
R8776:Mpo	UTSW	11	87802712	missense	possibly damaging	0.50
R8776-TAIL:Mpo	UTSW	11	87802712	missense	possibly damaging	0.50
R8807:Mpo	UTSW	11	87796339	missense	probably benign	0.05
R8829:Mpo	UTSW	11	87803424	missense	probably damaging	1.00
R9272:Mpo	UTSW	11	87795867	missense	probably benign	0.01
RF018:Mpo	UTSW	11	87797639	missense	probably damaging	1.00
Z1088:Mpo	UTSW	11	87795245	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- ACGCAGGATACAATGCCTGG -3'
(R):5'- ACCCAGAGAACCTATTAAGAGTG -3'

Sequencing Primer
(F):5'- ATACAATGCCTGGAGACGCTTTTG -3'
(R):5'- GGCTGAGAACTTGACTACCATC -3'

Posted On

2016-03-17