Incidental Mutation 'R4892:Tcf20'
ID 377359
Institutional Source Beutler Lab
Gene Symbol Tcf20
Ensembl Gene ENSMUSG00000041852
Gene Name transcription factor 20
Synonyms stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik, SPBP
MMRRC Submission 042497-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock # R4892 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 82808436-82987872 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 82854199 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 1017 (R1017Q)
Ref Sequence ENSEMBL: ENSMUSP00000105136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510] [ENSMUST00000229439] [ENSMUST00000229547] [ENSMUST00000230403]
AlphaFold Q9EPQ8
Predicted Effect possibly damaging
Transcript: ENSMUST00000048966
AA Change: R1017Q

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: R1017Q

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109510
AA Change: R1017Q

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: R1017Q

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229439
Predicted Effect probably benign
Transcript: ENSMUST00000229547
Predicted Effect probably benign
Transcript: ENSMUST00000230403
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,509,802 T1128A probably benign Het
Apol11a A T 15: 77,516,990 K226* probably null Het
Atp4a A G 7: 30,712,474 M45V probably benign Het
Babam1 T A 8: 71,403,052 M263K probably benign Het
Capn11 GACA GA 17: 45,633,097 probably null Het
Ccdc190 C A 1: 169,930,109 L46I possibly damaging Het
Cep131 C T 11: 120,068,057 R717H probably damaging Het
Cpt1c A G 7: 44,959,588 F770L probably benign Het
Dhx30 A T 9: 110,085,856 probably null Het
Dido1 G A 2: 180,675,029 Q662* probably null Het
Dip2a T C 10: 76,280,759 E910G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fmo3 T A 1: 162,968,731 I91F probably benign Het
Gdap1 A C 1: 17,159,994 D217A possibly damaging Het
Grm1 T C 10: 10,719,587 S766G possibly damaging Het
Kat8 T A 7: 127,915,538 I123N possibly damaging Het
Kcnt2 C A 1: 140,513,025 S23* probably null Het
Krt73 G A 15: 101,795,809 T432I probably damaging Het
Lgals9 T A 11: 78,966,083 I223L probably benign Het
Mpo T A 11: 87,802,681 N48K probably benign Het
Myo9a T G 9: 59,824,242 H632Q probably damaging Het
Olfr1386 C A 11: 49,470,216 Q22K probably benign Het
Olfr1412 A G 1: 92,588,921 N197S probably benign Het
Prelid2 A G 18: 41,951,144 F11S possibly damaging Het
Setd1a G T 7: 127,778,524 V57L probably damaging Het
Sgip1 A G 4: 102,966,234 D704G probably damaging Het
Spryd3 T C 15: 102,118,102 E378G probably benign Het
Stk17b A T 1: 53,771,611 Y112N probably damaging Het
Syndig1 A T 2: 149,899,891 K132N probably damaging Het
Tenm3 T A 8: 48,276,861 D1370V probably damaging Het
Tnrc6a C T 7: 123,169,911 T308I probably damaging Het
Ttc29 T C 8: 78,333,645 V398A probably damaging Het
Ubr4 A G 4: 139,428,517 T2218A probably benign Het
Other mutations in Tcf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tcf20 APN 15 82854895 missense probably damaging 1.00
IGL00229:Tcf20 APN 15 82857142 missense possibly damaging 0.50
IGL00539:Tcf20 APN 15 82852756 missense probably benign 0.41
IGL00576:Tcf20 APN 15 82856075 missense probably damaging 1.00
IGL01135:Tcf20 APN 15 82853900 missense probably benign
IGL01670:Tcf20 APN 15 82855363 missense possibly damaging 0.77
IGL01684:Tcf20 APN 15 82857160 missense probably damaging 1.00
IGL01767:Tcf20 APN 15 82856008 missense probably damaging 1.00
IGL01825:Tcf20 APN 15 82852966 missense probably benign
IGL01834:Tcf20 APN 15 82855697 missense probably damaging 0.99
IGL01836:Tcf20 APN 15 82855155 missense probably damaging 0.99
IGL02415:Tcf20 APN 15 82853459 missense probably benign 0.28
IGL02731:Tcf20 APN 15 82853237 missense probably benign 0.00
IGL02739:Tcf20 APN 15 82856080 missense probably damaging 1.00
IGL03058:Tcf20 APN 15 82852004 missense probably damaging 0.96
PIT4131001:Tcf20 UTSW 15 82851584 missense probably damaging 0.96
R0184:Tcf20 UTSW 15 82852300 missense probably damaging 0.99
R0207:Tcf20 UTSW 15 82855085 missense probably benign
R0732:Tcf20 UTSW 15 82852303 missense probably benign 0.07
R1502:Tcf20 UTSW 15 82855576 missense probably damaging 1.00
R1575:Tcf20 UTSW 15 82855492 missense probably benign 0.19
R1719:Tcf20 UTSW 15 82852777 missense probably benign 0.03
R1997:Tcf20 UTSW 15 82857230 nonsense probably null
R2152:Tcf20 UTSW 15 82855602 missense probably damaging 1.00
R2173:Tcf20 UTSW 15 82854692 missense possibly damaging 0.62
R2288:Tcf20 UTSW 15 82851685 missense probably benign
R4049:Tcf20 UTSW 15 82853429 missense probably damaging 1.00
R4496:Tcf20 UTSW 15 82854984 missense probably damaging 1.00
R4704:Tcf20 UTSW 15 82851727 missense possibly damaging 0.49
R5164:Tcf20 UTSW 15 82856603 missense probably damaging 1.00
R5207:Tcf20 UTSW 15 82856185 missense probably damaging 0.98
R5219:Tcf20 UTSW 15 82856381 missense probably damaging 1.00
R5228:Tcf20 UTSW 15 82855955 missense probably benign 0.01
R5288:Tcf20 UTSW 15 82855709 missense possibly damaging 0.50
R5374:Tcf20 UTSW 15 82851957 missense probably damaging 0.99
R5384:Tcf20 UTSW 15 82856199 missense probably damaging 0.99
R5677:Tcf20 UTSW 15 82853242 missense probably benign 0.05
R5897:Tcf20 UTSW 15 82851783 nonsense probably null
R6089:Tcf20 UTSW 15 82853208 missense probably benign 0.06
R6196:Tcf20 UTSW 15 82851986 missense possibly damaging 0.89
R6229:Tcf20 UTSW 15 82854880 missense probably damaging 1.00
R6448:Tcf20 UTSW 15 82852660 missense probably benign
R6688:Tcf20 UTSW 15 82854535 missense possibly damaging 0.68
R7009:Tcf20 UTSW 15 82854682 missense probably benign 0.07
R7051:Tcf20 UTSW 15 82856078 missense probably damaging 1.00
R7215:Tcf20 UTSW 15 82853489 missense probably benign
R7486:Tcf20 UTSW 15 82853734 missense possibly damaging 0.78
R7583:Tcf20 UTSW 15 82855276 missense possibly damaging 0.82
R7678:Tcf20 UTSW 15 82851565 missense possibly damaging 0.92
R8090:Tcf20 UTSW 15 82856006 missense probably damaging 1.00
R8156:Tcf20 UTSW 15 82852937 missense probably benign 0.00
R8191:Tcf20 UTSW 15 82853405 nonsense probably null
R8259:Tcf20 UTSW 15 82852273 missense probably damaging 1.00
R8339:Tcf20 UTSW 15 82852676 missense probably benign 0.04
R8447:Tcf20 UTSW 15 82853236 missense possibly damaging 0.77
R8497:Tcf20 UTSW 15 82855951 missense probably benign 0.07
R8728:Tcf20 UTSW 15 82854957 missense probably damaging 1.00
R8829:Tcf20 UTSW 15 82855714 missense probably damaging 1.00
R8861:Tcf20 UTSW 15 82852525 missense probably damaging 0.99
R9177:Tcf20 UTSW 15 82856504 missense probably benign 0.00
R9268:Tcf20 UTSW 15 82856504 missense probably benign 0.00
R9294:Tcf20 UTSW 15 82852696 missense probably benign 0.11
RF019:Tcf20 UTSW 15 82851593 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGAACTCCTATTGGCCCTCTC -3'
(R):5'- GGGTTGGTGTCCATGGAAAC -3'

Sequencing Primer
(F):5'- ATTGGCCCTCTCTGAAAAGG -3'
(R):5'- TTGAAATCCCAGAGTGGACAG -3'
Posted On 2016-03-17