Mutagenetix > Incidental Mutation

Incidental Mutation 'R4892:Tcf20'

377359

Institutional Source

Beutler Lab

Gene Symbol

Tcf20

Ensembl Gene

ENSMUSG00000041852

Gene Name

transcription factor 20

Synonyms

stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik, SPBP

MMRRC Submission

042497-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.643) question?

Stock #

R4892 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82808436-82987872 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 82854199 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 1017 (R1017Q)

Ref Sequence

ENSEMBL: ENSMUSP00000105136 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510] [ENSMUST00000229439] [ENSMUST00000229547] [ENSMUST00000230403]

AlphaFold

Q9EPQ8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048966
AA Change: R1017Q

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: R1017Q

Domain	Start	End	E-Value	Type
low complexity region	42	74	N/A	INTRINSIC
coiled coil region	163	203	N/A	INTRINSIC
low complexity region	248	277	N/A	INTRINSIC
low complexity region	322	354	N/A	INTRINSIC
low complexity region	396	416	N/A	INTRINSIC
low complexity region	443	456	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC
low complexity region	511	523	N/A	INTRINSIC
low complexity region	684	715	N/A	INTRINSIC
low complexity region	1047	1056	N/A	INTRINSIC
low complexity region	1532	1544	N/A	INTRINSIC
low complexity region	1577	1593	N/A	INTRINSIC
low complexity region	1602	1617	N/A	INTRINSIC
low complexity region	1793	1804	N/A	INTRINSIC
low complexity region	1860	1874	N/A	INTRINSIC
PHD	1913	1960	6.7e-6	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109510
AA Change: R1017Q

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: R1017Q

Domain	Start	End	E-Value	Type
low complexity region	42	74	N/A	INTRINSIC
coiled coil region	163	203	N/A	INTRINSIC
low complexity region	248	277	N/A	INTRINSIC
low complexity region	322	354	N/A	INTRINSIC
low complexity region	396	416	N/A	INTRINSIC
low complexity region	443	456	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC
low complexity region	511	523	N/A	INTRINSIC
low complexity region	684	715	N/A	INTRINSIC
low complexity region	1047	1056	N/A	INTRINSIC
low complexity region	1532	1544	N/A	INTRINSIC
low complexity region	1577	1593	N/A	INTRINSIC
low complexity region	1602	1617	N/A	INTRINSIC
low complexity region	1793	1804	N/A	INTRINSIC
low complexity region	1860	1874	N/A	INTRINSIC
PHD	1913	1960	6.7e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000229439

Predicted Effect

probably benign
Transcript: ENSMUST00000229547

Predicted Effect

probably benign
Transcript: ENSMUST00000230403

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	T	C	8: 86,509,802	T1128A	probably benign	Het
Apol11a	A	T	15: 77,516,990	K226*	probably null	Het
Atp4a	A	G	7: 30,712,474	M45V	probably benign	Het
Babam1	T	A	8: 71,403,052	M263K	probably benign	Het
Capn11	GACA	GA	17: 45,633,097		probably null	Het
Ccdc190	C	A	1: 169,930,109	L46I	possibly damaging	Het
Cep131	C	T	11: 120,068,057	R717H	probably damaging	Het
Cpt1c	A	G	7: 44,959,588	F770L	probably benign	Het
Dhx30	A	T	9: 110,085,856		probably null	Het
Dido1	G	A	2: 180,675,029	Q662*	probably null	Het
Dip2a	T	C	10: 76,280,759	E910G	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Fmo3	T	A	1: 162,968,731	I91F	probably benign	Het
Gdap1	A	C	1: 17,159,994	D217A	possibly damaging	Het
Grm1	T	C	10: 10,719,587	S766G	possibly damaging	Het
Kat8	T	A	7: 127,915,538	I123N	possibly damaging	Het
Kcnt2	C	A	1: 140,513,025	S23*	probably null	Het
Krt73	G	A	15: 101,795,809	T432I	probably damaging	Het
Lgals9	T	A	11: 78,966,083	I223L	probably benign	Het
Mpo	T	A	11: 87,802,681	N48K	probably benign	Het
Myo9a	T	G	9: 59,824,242	H632Q	probably damaging	Het
Olfr1386	C	A	11: 49,470,216	Q22K	probably benign	Het
Olfr1412	A	G	1: 92,588,921	N197S	probably benign	Het
Prelid2	A	G	18: 41,951,144	F11S	possibly damaging	Het
Setd1a	G	T	7: 127,778,524	V57L	probably damaging	Het
Sgip1	A	G	4: 102,966,234	D704G	probably damaging	Het
Spryd3	T	C	15: 102,118,102	E378G	probably benign	Het
Stk17b	A	T	1: 53,771,611	Y112N	probably damaging	Het
Syndig1	A	T	2: 149,899,891	K132N	probably damaging	Het
Tenm3	T	A	8: 48,276,861	D1370V	probably damaging	Het
Tnrc6a	C	T	7: 123,169,911	T308I	probably damaging	Het
Ttc29	T	C	8: 78,333,645	V398A	probably damaging	Het
Ubr4	A	G	4: 139,428,517	T2218A	probably benign	Het

Other mutations in Tcf20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Tcf20	APN	15	82854895	missense	probably damaging	1.00
IGL00229:Tcf20	APN	15	82857142	missense	possibly damaging	0.50
IGL00539:Tcf20	APN	15	82852756	missense	probably benign	0.41
IGL00576:Tcf20	APN	15	82856075	missense	probably damaging	1.00
IGL01135:Tcf20	APN	15	82853900	missense	probably benign
IGL01670:Tcf20	APN	15	82855363	missense	possibly damaging	0.77
IGL01684:Tcf20	APN	15	82857160	missense	probably damaging	1.00
IGL01767:Tcf20	APN	15	82856008	missense	probably damaging	1.00
IGL01825:Tcf20	APN	15	82852966	missense	probably benign
IGL01834:Tcf20	APN	15	82855697	missense	probably damaging	0.99
IGL01836:Tcf20	APN	15	82855155	missense	probably damaging	0.99
IGL02415:Tcf20	APN	15	82853459	missense	probably benign	0.28
IGL02731:Tcf20	APN	15	82853237	missense	probably benign	0.00
IGL02739:Tcf20	APN	15	82856080	missense	probably damaging	1.00
IGL03058:Tcf20	APN	15	82852004	missense	probably damaging	0.96
PIT4131001:Tcf20	UTSW	15	82851584	missense	probably damaging	0.96
R0184:Tcf20	UTSW	15	82852300	missense	probably damaging	0.99
R0207:Tcf20	UTSW	15	82855085	missense	probably benign
R0732:Tcf20	UTSW	15	82852303	missense	probably benign	0.07
R1502:Tcf20	UTSW	15	82855576	missense	probably damaging	1.00
R1575:Tcf20	UTSW	15	82855492	missense	probably benign	0.19
R1719:Tcf20	UTSW	15	82852777	missense	probably benign	0.03
R1997:Tcf20	UTSW	15	82857230	nonsense	probably null
R2152:Tcf20	UTSW	15	82855602	missense	probably damaging	1.00
R2173:Tcf20	UTSW	15	82854692	missense	possibly damaging	0.62
R2288:Tcf20	UTSW	15	82851685	missense	probably benign
R4049:Tcf20	UTSW	15	82853429	missense	probably damaging	1.00
R4496:Tcf20	UTSW	15	82854984	missense	probably damaging	1.00
R4704:Tcf20	UTSW	15	82851727	missense	possibly damaging	0.49
R5164:Tcf20	UTSW	15	82856603	missense	probably damaging	1.00
R5207:Tcf20	UTSW	15	82856185	missense	probably damaging	0.98
R5219:Tcf20	UTSW	15	82856381	missense	probably damaging	1.00
R5228:Tcf20	UTSW	15	82855955	missense	probably benign	0.01
R5288:Tcf20	UTSW	15	82855709	missense	possibly damaging	0.50
R5374:Tcf20	UTSW	15	82851957	missense	probably damaging	0.99
R5384:Tcf20	UTSW	15	82856199	missense	probably damaging	0.99
R5677:Tcf20	UTSW	15	82853242	missense	probably benign	0.05
R5897:Tcf20	UTSW	15	82851783	nonsense	probably null
R6089:Tcf20	UTSW	15	82853208	missense	probably benign	0.06
R6196:Tcf20	UTSW	15	82851986	missense	possibly damaging	0.89
R6229:Tcf20	UTSW	15	82854880	missense	probably damaging	1.00
R6448:Tcf20	UTSW	15	82852660	missense	probably benign
R6688:Tcf20	UTSW	15	82854535	missense	possibly damaging	0.68
R7009:Tcf20	UTSW	15	82854682	missense	probably benign	0.07
R7051:Tcf20	UTSW	15	82856078	missense	probably damaging	1.00
R7215:Tcf20	UTSW	15	82853489	missense	probably benign
R7486:Tcf20	UTSW	15	82853734	missense	possibly damaging	0.78
R7583:Tcf20	UTSW	15	82855276	missense	possibly damaging	0.82
R7678:Tcf20	UTSW	15	82851565	missense	possibly damaging	0.92
R8090:Tcf20	UTSW	15	82856006	missense	probably damaging	1.00
R8156:Tcf20	UTSW	15	82852937	missense	probably benign	0.00
R8191:Tcf20	UTSW	15	82853405	nonsense	probably null
R8259:Tcf20	UTSW	15	82852273	missense	probably damaging	1.00
R8339:Tcf20	UTSW	15	82852676	missense	probably benign	0.04
R8447:Tcf20	UTSW	15	82853236	missense	possibly damaging	0.77
R8497:Tcf20	UTSW	15	82855951	missense	probably benign	0.07
R8728:Tcf20	UTSW	15	82854957	missense	probably damaging	1.00
R8829:Tcf20	UTSW	15	82855714	missense	probably damaging	1.00
R8861:Tcf20	UTSW	15	82852525	missense	probably damaging	0.99
R9177:Tcf20	UTSW	15	82856504	missense	probably benign	0.00
R9268:Tcf20	UTSW	15	82856504	missense	probably benign	0.00
R9294:Tcf20	UTSW	15	82852696	missense	probably benign	0.11
R9648:Tcf20	UTSW	15	82855675	missense	probably damaging	1.00
R9675:Tcf20	UTSW	15	82856785	missense	probably damaging	1.00
R9729:Tcf20	UTSW	15	82851836	missense	probably benign	0.25
RF019:Tcf20	UTSW	15	82851593	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAAGAACTCCTATTGGCCCTCTC -3'
(R):5'- GGGTTGGTGTCCATGGAAAC -3'

Sequencing Primer
(F):5'- ATTGGCCCTCTCTGAAAAGG -3'
(R):5'- TTGAAATCCCAGAGTGGACAG -3'

Posted On

2016-03-17