Incidental Mutation 'R4892:Krt73'
ID 377360
Institutional Source Beutler Lab
Gene Symbol Krt73
Ensembl Gene ENSMUSG00000063661
Gene Name keratin 73
Synonyms
MMRRC Submission 042497-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock # R4892 (G1)
Quality Score 217
Status Not validated
Chromosome 15
Chromosomal Location 101793308-101802346 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 101795809 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 432 (T432I)
Ref Sequence ENSEMBL: ENSMUSP00000065349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063292]
AlphaFold Q6NXH9
Predicted Effect probably damaging
Transcript: ENSMUST00000063292
AA Change: T432I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065349
Gene: ENSMUSG00000063661
AA Change: T432I

DomainStartEndE-ValueType
low complexity region 17 57 N/A INTRINSIC
Pfam:Keratin_2_head 59 127 1.4e-19 PFAM
Filament 130 443 5.39e-159 SMART
low complexity region 450 461 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes a protein that is expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,509,802 T1128A probably benign Het
Apol11a A T 15: 77,516,990 K226* probably null Het
Atp4a A G 7: 30,712,474 M45V probably benign Het
Babam1 T A 8: 71,403,052 M263K probably benign Het
Capn11 GACA GA 17: 45,633,097 probably null Het
Ccdc190 C A 1: 169,930,109 L46I possibly damaging Het
Cep131 C T 11: 120,068,057 R717H probably damaging Het
Cpt1c A G 7: 44,959,588 F770L probably benign Het
Dhx30 A T 9: 110,085,856 probably null Het
Dido1 G A 2: 180,675,029 Q662* probably null Het
Dip2a T C 10: 76,280,759 E910G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fmo3 T A 1: 162,968,731 I91F probably benign Het
Gdap1 A C 1: 17,159,994 D217A possibly damaging Het
Grm1 T C 10: 10,719,587 S766G possibly damaging Het
Kat8 T A 7: 127,915,538 I123N possibly damaging Het
Kcnt2 C A 1: 140,513,025 S23* probably null Het
Lgals9 T A 11: 78,966,083 I223L probably benign Het
Mpo T A 11: 87,802,681 N48K probably benign Het
Myo9a T G 9: 59,824,242 H632Q probably damaging Het
Olfr1386 C A 11: 49,470,216 Q22K probably benign Het
Olfr1412 A G 1: 92,588,921 N197S probably benign Het
Prelid2 A G 18: 41,951,144 F11S possibly damaging Het
Setd1a G T 7: 127,778,524 V57L probably damaging Het
Sgip1 A G 4: 102,966,234 D704G probably damaging Het
Spryd3 T C 15: 102,118,102 E378G probably benign Het
Stk17b A T 1: 53,771,611 Y112N probably damaging Het
Syndig1 A T 2: 149,899,891 K132N probably damaging Het
Tcf20 C T 15: 82,854,199 R1017Q possibly damaging Het
Tenm3 T A 8: 48,276,861 D1370V probably damaging Het
Tnrc6a C T 7: 123,169,911 T308I probably damaging Het
Ttc29 T C 8: 78,333,645 V398A probably damaging Het
Ubr4 A G 4: 139,428,517 T2218A probably benign Het
Other mutations in Krt73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Krt73 APN 15 101798937 critical splice acceptor site probably null
IGL01768:Krt73 APN 15 101798856 missense probably benign 0.01
IGL01836:Krt73 APN 15 101795896 missense probably benign 0.38
IGL02058:Krt73 APN 15 101802021 missense probably benign
IGL02063:Krt73 APN 15 101795769 splice site probably benign
IGL02076:Krt73 APN 15 101799935 missense probably damaging 1.00
IGL02878:Krt73 APN 15 101798826 missense probably damaging 1.00
IGL03127:Krt73 APN 15 101795840 missense probably benign
R0032:Krt73 UTSW 15 101794052 missense probably benign 0.30
R0109:Krt73 UTSW 15 101796395 nonsense probably null
R0143:Krt73 UTSW 15 101800773 missense probably damaging 1.00
R0233:Krt73 UTSW 15 101802016 missense probably benign 0.12
R0233:Krt73 UTSW 15 101802016 missense probably benign 0.12
R0254:Krt73 UTSW 15 101799889 splice site probably benign
R0256:Krt73 UTSW 15 101801936 missense probably damaging 1.00
R0497:Krt73 UTSW 15 101802230 missense probably damaging 0.99
R1592:Krt73 UTSW 15 101802239 nonsense probably null
R1681:Krt73 UTSW 15 101802047 missense possibly damaging 0.70
R1696:Krt73 UTSW 15 101799909 missense probably damaging 1.00
R1766:Krt73 UTSW 15 101793928 missense probably damaging 1.00
R2031:Krt73 UTSW 15 101798764 splice site probably benign
R2171:Krt73 UTSW 15 101800910 missense possibly damaging 0.88
R4674:Krt73 UTSW 15 101802075 missense probably benign 0.22
R4777:Krt73 UTSW 15 101794001 missense probably benign
R4869:Krt73 UTSW 15 101796398 missense probably damaging 1.00
R5794:Krt73 UTSW 15 101794829 missense probably benign 0.00
R6807:Krt73 UTSW 15 101796407 missense probably damaging 1.00
R6885:Krt73 UTSW 15 101796398 missense probably damaging 1.00
R7489:Krt73 UTSW 15 101793859 missense probably benign 0.00
R7682:Krt73 UTSW 15 101802045 missense probably benign 0.08
R9167:Krt73 UTSW 15 101793970 missense probably benign 0.00
Z1177:Krt73 UTSW 15 101793811 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGCCGAGACTCTGAAAAG -3'
(R):5'- CCAATCTAGAGACAGCCATTGC -3'

Sequencing Primer
(F):5'- AGGAGACTTTAAAGAGCATTGCTGC -3'
(R):5'- CCATTGCTGATGCTGAGCAG -3'
Posted On 2016-03-17