Incidental Mutation 'R4892:Spryd3'
ID 377361
Institutional Source Beutler Lab
Gene Symbol Spryd3
Ensembl Gene ENSMUSG00000036966
Gene Name SPRY domain containing 3
Synonyms
MMRRC Submission 042497-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4892 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 102116528-102136234 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102118102 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 378 (E378G)
Ref Sequence ENSEMBL: ENSMUSP00000121493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046144] [ENSMUST00000154032] [ENSMUST00000169627] [ENSMUST00000228958] [ENSMUST00000230474]
AlphaFold E9Q9B3
Predicted Effect probably benign
Transcript: ENSMUST00000046144
SMART Domains Protein: ENSMUSP00000041087
Gene: ENSMUSG00000037003

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1136 1236 1.69e-16 SMART
PTB 1269 1407 6.66e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139279
Predicted Effect probably benign
Transcript: ENSMUST00000154032
AA Change: E378G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000121493
Gene: ENSMUSG00000036966
AA Change: E378G

DomainStartEndE-ValueType
low complexity region 28 38 N/A INTRINSIC
SPRY 76 201 1.66e-11 SMART
SPRY 256 441 3.28e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169627
SMART Domains Protein: ENSMUSP00000129146
Gene: ENSMUSG00000037003

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1129 1229 1.69e-16 SMART
PTB 1262 1400 6.66e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229800
Predicted Effect probably benign
Transcript: ENSMUST00000230474
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,509,802 T1128A probably benign Het
Apol11a A T 15: 77,516,990 K226* probably null Het
Atp4a A G 7: 30,712,474 M45V probably benign Het
Babam1 T A 8: 71,403,052 M263K probably benign Het
Capn11 GACA GA 17: 45,633,097 probably null Het
Ccdc190 C A 1: 169,930,109 L46I possibly damaging Het
Cep131 C T 11: 120,068,057 R717H probably damaging Het
Cpt1c A G 7: 44,959,588 F770L probably benign Het
Dhx30 A T 9: 110,085,856 probably null Het
Dido1 G A 2: 180,675,029 Q662* probably null Het
Dip2a T C 10: 76,280,759 E910G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fmo3 T A 1: 162,968,731 I91F probably benign Het
Gdap1 A C 1: 17,159,994 D217A possibly damaging Het
Grm1 T C 10: 10,719,587 S766G possibly damaging Het
Kat8 T A 7: 127,915,538 I123N possibly damaging Het
Kcnt2 C A 1: 140,513,025 S23* probably null Het
Krt73 G A 15: 101,795,809 T432I probably damaging Het
Lgals9 T A 11: 78,966,083 I223L probably benign Het
Mpo T A 11: 87,802,681 N48K probably benign Het
Myo9a T G 9: 59,824,242 H632Q probably damaging Het
Olfr1386 C A 11: 49,470,216 Q22K probably benign Het
Olfr1412 A G 1: 92,588,921 N197S probably benign Het
Prelid2 A G 18: 41,951,144 F11S possibly damaging Het
Setd1a G T 7: 127,778,524 V57L probably damaging Het
Sgip1 A G 4: 102,966,234 D704G probably damaging Het
Stk17b A T 1: 53,771,611 Y112N probably damaging Het
Syndig1 A T 2: 149,899,891 K132N probably damaging Het
Tcf20 C T 15: 82,854,199 R1017Q possibly damaging Het
Tenm3 T A 8: 48,276,861 D1370V probably damaging Het
Tnrc6a C T 7: 123,169,911 T308I probably damaging Het
Ttc29 T C 8: 78,333,645 V398A probably damaging Het
Ubr4 A G 4: 139,428,517 T2218A probably benign Het
Other mutations in Spryd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Spryd3 APN 15 102130276 critical splice donor site probably null
IGL02138:Spryd3 APN 15 102118919 unclassified probably benign
IGL02652:Spryd3 APN 15 102118990 splice site probably null
IGL02716:Spryd3 APN 15 102133461 missense possibly damaging 0.91
IGL02949:Spryd3 APN 15 102118109 missense probably benign 0.03
B6819:Spryd3 UTSW 15 102118141 missense probably benign 0.01
BB001:Spryd3 UTSW 15 102118327 missense probably benign 0.18
BB011:Spryd3 UTSW 15 102118327 missense probably benign 0.18
K7894:Spryd3 UTSW 15 102118141 missense probably benign 0.01
R0111:Spryd3 UTSW 15 102128537 critical splice donor site probably null
R0479:Spryd3 UTSW 15 102130400 nonsense probably null
R0654:Spryd3 UTSW 15 102128534 splice site probably null
R1014:Spryd3 UTSW 15 102133531 missense probably damaging 0.98
R1448:Spryd3 UTSW 15 102118392 missense possibly damaging 0.93
R1510:Spryd3 UTSW 15 102118961 missense probably damaging 0.99
R1863:Spryd3 UTSW 15 102117659 missense probably benign 0.17
R2069:Spryd3 UTSW 15 102118181 missense probably benign 0.01
R2212:Spryd3 UTSW 15 102130276 critical splice donor site probably null
R4581:Spryd3 UTSW 15 102130364 missense probably damaging 0.98
R5068:Spryd3 UTSW 15 102128611 missense probably benign 0.02
R5586:Spryd3 UTSW 15 102131937 missense probably benign
R5771:Spryd3 UTSW 15 102116907 unclassified probably benign
R5945:Spryd3 UTSW 15 102118195 missense probably benign 0.22
R7080:Spryd3 UTSW 15 102118192 missense probably benign 0.04
R7816:Spryd3 UTSW 15 102117706 missense probably damaging 0.99
R7924:Spryd3 UTSW 15 102118327 missense probably benign 0.18
R8524:Spryd3 UTSW 15 102118148 nonsense probably null
R8713:Spryd3 UTSW 15 102133485 missense possibly damaging 0.86
R9027:Spryd3 UTSW 15 102119408 missense probably damaging 0.99
R9187:Spryd3 UTSW 15 102130675 missense probably damaging 1.00
R9286:Spryd3 UTSW 15 102133434 missense possibly damaging 0.91
R9411:Spryd3 UTSW 15 102119408 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGAAAATAGACCAGGACTCC -3'
(R):5'- ACTACATTCTGGACAGCGAGG -3'

Sequencing Primer
(F):5'- TAGACCAGGACTCCAGCCTG -3'
(R):5'- CATTCTGGACAGCGAGGGTGAG -3'
Posted On 2016-03-17