Incidental Mutation 'R4892:Capn11'
ID 377364
Institutional Source Beutler Lab
Gene Symbol Capn11
Ensembl Gene ENSMUSG00000058626
Gene Name calpain 11
Synonyms
MMRRC Submission 042497-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4892 (G1)
Quality Score 217
Status Not validated
Chromosome 17
Chromosomal Location 45630204-45659325 bp(-) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) GACA to GA at 45633097 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120717]
AlphaFold Q6J756
Predicted Effect probably null
Transcript: ENSMUST00000120717
SMART Domains Protein: ENSMUSP00000113132
Gene: ENSMUSG00000058626

DomainStartEndE-ValueType
CysPc 37 362 2.75e-157 SMART
calpain_III 366 523 2.57e-84 SMART
EFh 590 618 3.91e-4 SMART
EFh 620 648 6.88e-1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains constitute a family of intracellular calcium-dependent cysteine proteases. There are eight members in this superfamily. They consist of a variable 80 kDa subunit and an invariant 30 kDa subunit. This calpain protein appears to have protease activity and calcium-binding ability. A similar mouse protein may play a functional role in spermatogenesis and in the regulation of calcium-dependent signal transduction events during meiosis. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,509,802 T1128A probably benign Het
Apol11a A T 15: 77,516,990 K226* probably null Het
Atp4a A G 7: 30,712,474 M45V probably benign Het
Babam1 T A 8: 71,403,052 M263K probably benign Het
Ccdc190 C A 1: 169,930,109 L46I possibly damaging Het
Cep131 C T 11: 120,068,057 R717H probably damaging Het
Cpt1c A G 7: 44,959,588 F770L probably benign Het
Dhx30 A T 9: 110,085,856 probably null Het
Dido1 G A 2: 180,675,029 Q662* probably null Het
Dip2a T C 10: 76,280,759 E910G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fmo3 T A 1: 162,968,731 I91F probably benign Het
Gdap1 A C 1: 17,159,994 D217A possibly damaging Het
Grm1 T C 10: 10,719,587 S766G possibly damaging Het
Kat8 T A 7: 127,915,538 I123N possibly damaging Het
Kcnt2 C A 1: 140,513,025 S23* probably null Het
Krt73 G A 15: 101,795,809 T432I probably damaging Het
Lgals9 T A 11: 78,966,083 I223L probably benign Het
Mpo T A 11: 87,802,681 N48K probably benign Het
Myo9a T G 9: 59,824,242 H632Q probably damaging Het
Olfr1386 C A 11: 49,470,216 Q22K probably benign Het
Olfr1412 A G 1: 92,588,921 N197S probably benign Het
Prelid2 A G 18: 41,951,144 F11S possibly damaging Het
Setd1a G T 7: 127,778,524 V57L probably damaging Het
Sgip1 A G 4: 102,966,234 D704G probably damaging Het
Spryd3 T C 15: 102,118,102 E378G probably benign Het
Stk17b A T 1: 53,771,611 Y112N probably damaging Het
Syndig1 A T 2: 149,899,891 K132N probably damaging Het
Tcf20 C T 15: 82,854,199 R1017Q possibly damaging Het
Tenm3 T A 8: 48,276,861 D1370V probably damaging Het
Tnrc6a C T 7: 123,169,911 T308I probably damaging Het
Ttc29 T C 8: 78,333,645 V398A probably damaging Het
Ubr4 A G 4: 139,428,517 T2218A probably benign Het
Other mutations in Capn11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Capn11 APN 17 45643767 missense probably damaging 1.00
IGL01116:Capn11 APN 17 45638880 unclassified probably benign
IGL01121:Capn11 APN 17 45639132 missense probably benign 0.04
IGL01366:Capn11 APN 17 45653200 missense probably damaging 1.00
IGL01533:Capn11 APN 17 45632904 missense probably benign
IGL01595:Capn11 APN 17 45639434 missense probably benign 0.02
IGL02197:Capn11 APN 17 45639856 missense probably benign 0.14
IGL02683:Capn11 APN 17 45653591 missense probably damaging 1.00
IGL02696:Capn11 APN 17 45632709 missense probably damaging 1.00
IGL02711:Capn11 APN 17 45632415 missense probably damaging 1.00
IGL02900:Capn11 APN 17 45630614 splice site probably null
IGL03033:Capn11 APN 17 45642547 missense probably damaging 1.00
R0883:Capn11 UTSW 17 45638881 unclassified probably benign
R1494:Capn11 UTSW 17 45643809 missense probably damaging 1.00
R1735:Capn11 UTSW 17 45632401 nonsense probably null
R1785:Capn11 UTSW 17 45638697 missense probably benign 0.02
R1952:Capn11 UTSW 17 45642959 missense probably damaging 1.00
R2149:Capn11 UTSW 17 45633107 critical splice acceptor site probably null
R2397:Capn11 UTSW 17 45653221 missense probably damaging 1.00
R2495:Capn11 UTSW 17 45638763 missense probably damaging 0.97
R2516:Capn11 UTSW 17 45633799 missense probably damaging 0.98
R3934:Capn11 UTSW 17 45634287 splice site probably benign
R4016:Capn11 UTSW 17 45653756 missense probably damaging 1.00
R4226:Capn11 UTSW 17 45642466 critical splice donor site probably null
R4227:Capn11 UTSW 17 45642466 critical splice donor site probably null
R4774:Capn11 UTSW 17 45633080 missense probably benign 0.00
R5244:Capn11 UTSW 17 45633892 missense probably damaging 1.00
R5667:Capn11 UTSW 17 45639674 missense possibly damaging 0.87
R5671:Capn11 UTSW 17 45639674 missense possibly damaging 0.87
R5991:Capn11 UTSW 17 45659352 splice site probably null
R6180:Capn11 UTSW 17 45630766 missense probably damaging 1.00
R6193:Capn11 UTSW 17 45653504 critical splice donor site probably null
R6774:Capn11 UTSW 17 45657330 intron probably benign
R7047:Capn11 UTSW 17 45638696 nonsense probably null
R7302:Capn11 UTSW 17 45643812 missense probably damaging 1.00
R7516:Capn11 UTSW 17 45638840 missense possibly damaging 0.95
R7563:Capn11 UTSW 17 45633965 missense probably damaging 0.99
R7718:Capn11 UTSW 17 45643781 missense probably damaging 1.00
R7999:Capn11 UTSW 17 45639206 missense probably damaging 1.00
R8058:Capn11 UTSW 17 45643755 missense probably null 1.00
R8194:Capn11 UTSW 17 45633399 missense probably damaging 0.96
R8737:Capn11 UTSW 17 45632875 missense probably benign 0.01
R8989:Capn11 UTSW 17 45643857 missense probably damaging 1.00
R9037:Capn11 UTSW 17 45639431 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCGCCATCCTAGGAGAAAC -3'
(R):5'- TCTCCAAGAGGTAACAGGAAGC -3'

Sequencing Primer
(F):5'- TTCGCCATCCTAGGAGAAACAGATG -3'
(R):5'- CAAGACAGGGTTTCTCTGTATAGCC -3'
Posted On 2016-03-17