Mutagenetix > Incidental Mutations

Incidental Mutation 'R4892:Capn11'

377364

Institutional Source

Beutler Lab

Gene Symbol

Capn11

Ensembl Gene

ENSMUSG00000058626

Gene Name

calpain 11

Synonyms

MMRRC Submission

042497-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4892 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

45630204-45659325 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

GACA to GA at 45633097 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113132 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120717]

AlphaFold

Q6J756

Predicted Effect

probably null
Transcript: ENSMUST00000120717

SMART Domains

Protein: ENSMUSP00000113132
Gene: ENSMUSG00000058626

Domain	Start	End	E-Value	Type
CysPc	37	362	2.75e-157	SMART
calpain_III	366	523	2.57e-84	SMART
EFh	590	618	3.91e-4	SMART
EFh	620	648	6.88e-1	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains constitute a family of intracellular calcium-dependent cysteine proteases. There are eight members in this superfamily. They consist of a variable 80 kDa subunit and an invariant 30 kDa subunit. This calpain protein appears to have protease activity and calcium-binding ability. A similar mouse protein may play a functional role in spermatogenesis and in the regulation of calcium-dependent signal transduction events during meiosis. [provided by RefSeq, Dec 2008]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	T	C	8: 86,509,802	T1128A	probably benign	Het
Apol11a	A	T	15: 77,516,990	K226*	probably null	Het
Atp4a	A	G	7: 30,712,474	M45V	probably benign	Het
Babam1	T	A	8: 71,403,052	M263K	probably benign	Het
Ccdc190	C	A	1: 169,930,109	L46I	possibly damaging	Het
Cep131	C	T	11: 120,068,057	R717H	probably damaging	Het
Cpt1c	A	G	7: 44,959,588	F770L	probably benign	Het
Dhx30	A	T	9: 110,085,856		probably null	Het
Dido1	G	A	2: 180,675,029	Q662*	probably null	Het
Dip2a	T	C	10: 76,280,759	E910G	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Fmo3	T	A	1: 162,968,731	I91F	probably benign	Het
Gdap1	A	C	1: 17,159,994	D217A	possibly damaging	Het
Grm1	T	C	10: 10,719,587	S766G	possibly damaging	Het
Kat8	T	A	7: 127,915,538	I123N	possibly damaging	Het
Kcnt2	C	A	1: 140,513,025	S23*	probably null	Het
Krt73	G	A	15: 101,795,809	T432I	probably damaging	Het
Lgals9	T	A	11: 78,966,083	I223L	probably benign	Het
Mpo	T	A	11: 87,802,681	N48K	probably benign	Het
Myo9a	T	G	9: 59,824,242	H632Q	probably damaging	Het
Olfr1386	C	A	11: 49,470,216	Q22K	probably benign	Het
Olfr1412	A	G	1: 92,588,921	N197S	probably benign	Het
Prelid2	A	G	18: 41,951,144	F11S	possibly damaging	Het
Setd1a	G	T	7: 127,778,524	V57L	probably damaging	Het
Sgip1	A	G	4: 102,966,234	D704G	probably damaging	Het
Spryd3	T	C	15: 102,118,102	E378G	probably benign	Het
Stk17b	A	T	1: 53,771,611	Y112N	probably damaging	Het
Syndig1	A	T	2: 149,899,891	K132N	probably damaging	Het
Tcf20	C	T	15: 82,854,199	R1017Q	possibly damaging	Het
Tenm3	T	A	8: 48,276,861	D1370V	probably damaging	Het
Tnrc6a	C	T	7: 123,169,911	T308I	probably damaging	Het
Ttc29	T	C	8: 78,333,645	V398A	probably damaging	Het
Ubr4	A	G	4: 139,428,517	T2218A	probably benign	Het

Other mutations in Capn11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Capn11	APN	17	45643767	missense	probably damaging	1.00
IGL01116:Capn11	APN	17	45638880	unclassified	probably benign
IGL01121:Capn11	APN	17	45639132	missense	probably benign	0.04
IGL01366:Capn11	APN	17	45653200	missense	probably damaging	1.00
IGL01533:Capn11	APN	17	45632904	missense	probably benign
IGL01595:Capn11	APN	17	45639434	missense	probably benign	0.02
IGL02197:Capn11	APN	17	45639856	missense	probably benign	0.14
IGL02683:Capn11	APN	17	45653591	missense	probably damaging	1.00
IGL02696:Capn11	APN	17	45632709	missense	probably damaging	1.00
IGL02711:Capn11	APN	17	45632415	missense	probably damaging	1.00
IGL02900:Capn11	APN	17	45630614	splice site	probably null
IGL03033:Capn11	APN	17	45642547	missense	probably damaging	1.00
R0883:Capn11	UTSW	17	45638881	unclassified	probably benign
R1494:Capn11	UTSW	17	45643809	missense	probably damaging	1.00
R1735:Capn11	UTSW	17	45632401	nonsense	probably null
R1785:Capn11	UTSW	17	45638697	missense	probably benign	0.02
R1952:Capn11	UTSW	17	45642959	missense	probably damaging	1.00
R2149:Capn11	UTSW	17	45633107	critical splice acceptor site	probably null
R2397:Capn11	UTSW	17	45653221	missense	probably damaging	1.00
R2495:Capn11	UTSW	17	45638763	missense	probably damaging	0.97
R2516:Capn11	UTSW	17	45633799	missense	probably damaging	0.98
R3934:Capn11	UTSW	17	45634287	splice site	probably benign
R4016:Capn11	UTSW	17	45653756	missense	probably damaging	1.00
R4226:Capn11	UTSW	17	45642466	critical splice donor site	probably null
R4227:Capn11	UTSW	17	45642466	critical splice donor site	probably null
R4774:Capn11	UTSW	17	45633080	missense	probably benign	0.00
R5244:Capn11	UTSW	17	45633892	missense	probably damaging	1.00
R5667:Capn11	UTSW	17	45639674	missense	possibly damaging	0.87
R5671:Capn11	UTSW	17	45639674	missense	possibly damaging	0.87
R5991:Capn11	UTSW	17	45659352	splice site	probably null
R6180:Capn11	UTSW	17	45630766	missense	probably damaging	1.00
R6193:Capn11	UTSW	17	45653504	critical splice donor site	probably null
R6774:Capn11	UTSW	17	45657330	intron	probably benign
R7047:Capn11	UTSW	17	45638696	nonsense	probably null
R7302:Capn11	UTSW	17	45643812	missense	probably damaging	1.00
R7516:Capn11	UTSW	17	45638840	missense	possibly damaging	0.95
R7563:Capn11	UTSW	17	45633965	missense	probably damaging	0.99
R7718:Capn11	UTSW	17	45643781	missense	probably damaging	1.00
R7999:Capn11	UTSW	17	45639206	missense	probably damaging	1.00
R8058:Capn11	UTSW	17	45643755	missense	probably null	1.00
R8194:Capn11	UTSW	17	45633399	missense	probably damaging	0.96
R8737:Capn11	UTSW	17	45632875	missense	probably benign	0.01
R8989:Capn11	UTSW	17	45643857	missense	probably damaging	1.00
R9037:Capn11	UTSW	17	45639431	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTCGCCATCCTAGGAGAAAC -3'
(R):5'- TCTCCAAGAGGTAACAGGAAGC -3'

Sequencing Primer
(F):5'- TTCGCCATCCTAGGAGAAACAGATG -3'
(R):5'- CAAGACAGGGTTTCTCTGTATAGCC -3'

Posted On

2016-03-17