Incidental Mutation 'R4893:Aspm'
ID 377372
Institutional Source Beutler Lab
Gene Symbol Aspm
Ensembl Gene ENSMUSG00000033952
Gene Name abnormal spindle microtubule assembly
Synonyms Aspm, Sha1, MCPH5, D330028K02Rik, Calmbp1
MMRRC Submission 042498-MU
Accession Numbers

Genbank: NM_009791; MGI: 1334448
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4893 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 139454772-139494091 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 139489839 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053364] [ENSMUST00000200083]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000053364
SMART Domains Protein: ENSMUSP00000059159
Gene: ENSMUSG00000033952

DomainStartEndE-ValueType
Pfam:ASH 29 126 8.9e-35 PFAM
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 2.41e-4 SMART
IQ 1360 1382 2.12e1 SMART
IQ 1387 1408 7.61e1 SMART
IQ 1409 1431 6.97e0 SMART
IQ 1432 1452 1.44e1 SMART
IQ 1453 1475 1.15e-1 SMART
IQ 1476 1495 1.66e2 SMART
IQ 1503 1525 1.65e-2 SMART
IQ 1526 1548 1.32e1 SMART
IQ 1549 1571 1.48e1 SMART
IQ 1572 1594 2.5e1 SMART
IQ 1599 1621 2.58e-4 SMART
IQ 1622 1644 6.7e-3 SMART
IQ 1645 1667 4.25e1 SMART
IQ 1668 1694 1.03e2 SMART
IQ 1695 1717 2.33e-2 SMART
IQ 1718 1740 7.79e0 SMART
IQ 1741 1763 1.57e2 SMART
IQ 1768 1790 2.68e-2 SMART
IQ 1791 1813 5.83e-3 SMART
IQ 1814 1836 5.93e1 SMART
IQ 1841 1863 1.92e-3 SMART
IQ 1864 1886 3.79e-2 SMART
IQ 1914 1936 4.11e0 SMART
IQ 1937 1959 1.87e-1 SMART
IQ 1960 1982 6.27e1 SMART
IQ 1987 2009 8.25e-3 SMART
IQ 2010 2032 5.73e0 SMART
IQ 2060 2082 1.39e0 SMART
IQ 2083 2105 4.62e1 SMART
IQ 2133 2155 5.58e0 SMART
IQ 2156 2178 7.07e-2 SMART
IQ 2206 2228 1.18e-3 SMART
IQ 2229 2251 4.59e0 SMART
IQ 2278 2300 1.85e-5 SMART
IQ 2301 2323 8.13e-2 SMART
IQ 2342 2364 9.62e-4 SMART
IQ 2365 2387 4.12e-3 SMART
IQ 2415 2437 7.58e-2 SMART
IQ 2438 2460 2.6e0 SMART
IQ 2490 2512 1.68e-3 SMART
IQ 2513 2535 8.51e1 SMART
IQ 2560 2582 2.14e-1 SMART
IQ 2601 2623 8.46e0 SMART
IQ 2647 2669 1.15e1 SMART
IQ 2673 2695 1.95e-4 SMART
IQ 2696 2718 4.13e1 SMART
IQ 2723 2745 1.02e-2 SMART
IQ 2761 2783 3.14e2 SMART
IQ 2784 2806 1e1 SMART
IQ 2825 2847 2.43e0 SMART
IQ 2848 2870 4.6e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196272
Predicted Effect probably null
Transcript: ENSMUST00000200083
SMART Domains Protein: ENSMUSP00000142880
Gene: ENSMUSG00000033952

DomainStartEndE-ValueType
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 1.25e1 SMART
IQ 1337 1358 2.96e1 SMART
IQ 1382 1404 1.15e1 SMART
IQ 1408 1430 1.95e-4 SMART
IQ 1431 1453 4.13e1 SMART
IQ 1458 1480 1.02e-2 SMART
IQ 1496 1518 3.14e2 SMART
IQ 1519 1541 1e1 SMART
IQ 1560 1582 2.43e0 SMART
IQ 1583 1605 4.6e-1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for protein-truncating gene trap mutations of this gene exhibit decreased body weight, microcephaly, a severe reduction in brain, testis and ovary weight, oligozoospermia and asthenospermia, and reduced fertility in both sexes. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik A G 8: 116,971,165 I401T probably damaging Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
Acss1 C A 2: 150,629,866 V323F probably damaging Het
Adgrf3 T G 5: 30,200,478 D286A probably benign Het
Akap5 T C 12: 76,329,969 V718A probably damaging Het
Ankk1 A G 9: 49,415,683 V732A probably benign Het
Antxr2 T A 5: 98,004,072 D180V probably damaging Het
Arfgef2 T G 2: 166,866,956 F1063V probably benign Het
Ascl5 A T 1: 136,051,179 I126F probably damaging Het
Atf6b T C 17: 34,648,612 S100P probably damaging Het
Baz2a C A 10: 128,123,415 H1266Q possibly damaging Het
Cdh4 A T 2: 179,847,419 probably benign Het
Celsr3 C G 9: 108,849,421 S3283C probably damaging Het
Clca4b C T 3: 144,925,173 V309M possibly damaging Het
Cnbd2 T C 2: 156,365,184 Y436H probably damaging Het
Csnk1a1 T C 18: 61,585,301 probably benign Het
Cstf1 C T 2: 172,380,524 R401C probably damaging Het
Cul3 A G 1: 80,288,850 I117T probably damaging Het
Dlgap3 A G 4: 127,194,983 D124G probably damaging Het
Dnah12 A G 14: 26,710,170 D381G possibly damaging Het
Dtna T C 18: 23,569,667 L85P probably damaging Het
Ephb2 A G 4: 136,659,753 I722T probably damaging Het
Epn3 A T 11: 94,491,996 F421I probably damaging Het
Fam160b1 T A 19: 57,381,756 H477Q probably benign Het
Fam83f T A 15: 80,691,955 L269H probably damaging Het
Gata4 G A 14: 63,201,596 A139V probably benign Het
Glce T C 9: 62,068,495 D241G probably benign Het
Gm17728 A T 17: 9,422,231 I58F probably benign Het
Inhba A T 13: 16,026,549 D232V possibly damaging Het
Itgb2l C A 16: 96,427,821 R394L probably benign Het
Klhl14 T C 18: 21,557,935 Y486C probably damaging Het
Krt1 A G 15: 101,850,120 I203T probably damaging Het
Lims2 T C 18: 31,941,811 probably null Het
Lrrc31 T G 3: 30,679,297 I423L probably benign Het
Map7d1 C T 4: 126,233,222 D732N unknown Het
Mau2 A T 8: 70,030,640 probably null Het
Mbtps1 G A 8: 119,518,193 R840W probably damaging Het
Morn3 T C 5: 123,037,682 I214M probably damaging Het
Mrpl44 A G 1: 79,777,865 K63E probably damaging Het
Muc20 T C 16: 32,794,672 T112A possibly damaging Het
Myo6 T A 9: 80,228,877 L94Q probably damaging Het
Nos1 C A 5: 117,952,877 T1423K possibly damaging Het
Olfr166 A G 16: 19,486,903 T22A probably benign Het
Olfr31 T C 14: 14,328,852 V247A probably damaging Het
Pdzd2 T C 15: 12,385,343 T1114A probably benign Het
Pgm1 T C 5: 64,105,940 V310A probably benign Het
Pi4ka T C 16: 17,377,036 E166G probably benign Het
Pign A T 1: 105,646,711 D303E probably damaging Het
Pik3c3 G T 18: 30,282,000 V149L probably benign Het
Pkd1l3 A T 8: 109,638,394 Y1126F probably benign Het
Pkd2l1 T A 19: 44,153,771 Q516L probably benign Het
Pnliprp2 C A 19: 58,771,421 Q355K probably benign Het
Pnpla7 T A 2: 25,053,676 Y1314* probably null Het
Ppp1r1b A G 11: 98,355,344 T51A possibly damaging Het
Prkcd A T 14: 30,599,425 S544T probably damaging Het
Pusl1 G A 4: 155,889,541 T252I probably benign Het
Rnf44 A G 13: 54,681,932 probably null Het
Slc24a2 A T 4: 87,226,908 V303E probably damaging Het
Slc28a2 T A 2: 122,455,216 probably null Het
Sox8 T C 17: 25,568,989 D162G probably damaging Het
Spag1 T C 15: 36,197,846 probably null Het
Taar6 T C 10: 23,985,400 I83V probably benign Het
Tes T A 6: 17,104,596 C359S probably damaging Het
Vmn2r4 A T 3: 64,406,255 L435H probably damaging Het
Zfhx3 G T 8: 108,957,007 D3693Y unknown Het
Zfp931 G A 2: 178,068,203 P130L probably damaging Het
Zfr T G 15: 12,136,542 V95G unknown Het
Zw10 A G 9: 49,074,025 E587G possibly damaging Het
Other mutations in Aspm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Aspm APN 1 139478691 missense probably damaging 1.00
IGL00594:Aspm APN 1 139487422 splice site probably benign
IGL00808:Aspm APN 1 139461476 missense probably benign 0.03
IGL00897:Aspm APN 1 139477407 missense probably damaging 0.98
IGL01024:Aspm APN 1 139478124 missense possibly damaging 0.66
IGL01410:Aspm APN 1 139482444 missense probably benign 0.25
IGL01588:Aspm APN 1 139478162 missense probably benign 0.11
IGL01610:Aspm APN 1 139489670 nonsense probably null
IGL01633:Aspm APN 1 139480836 missense possibly damaging 0.93
IGL01982:Aspm APN 1 139491588 missense probably benign 0.12
IGL02429:Aspm APN 1 139479810 missense probably benign 0.27
IGL02468:Aspm APN 1 139480950 missense probably damaging 1.00
IGL02519:Aspm APN 1 139461927 splice site probably benign
IGL02526:Aspm APN 1 139489719 missense probably benign 0.03
IGL02716:Aspm APN 1 139479687 missense probably damaging 1.00
IGL02876:Aspm APN 1 139473653 missense probably damaging 1.00
IGL02953:Aspm APN 1 139457419 missense probably benign 0.01
IGL03275:Aspm APN 1 139487295 missense probably damaging 1.00
Stemware UTSW 1 139477459 nonsense probably null
3-1:Aspm UTSW 1 139457541 missense probably benign
R0016:Aspm UTSW 1 139479544 missense probably benign 0.01
R0016:Aspm UTSW 1 139479544 missense probably benign 0.01
R0106:Aspm UTSW 1 139476876 missense probably benign 0.02
R0106:Aspm UTSW 1 139476876 missense probably benign 0.02
R0140:Aspm UTSW 1 139480641 missense probably benign 0.00
R0195:Aspm UTSW 1 139479135 missense probably damaging 1.00
R0217:Aspm UTSW 1 139457880 missense possibly damaging 0.46
R0276:Aspm UTSW 1 139478471 missense possibly damaging 0.95
R0309:Aspm UTSW 1 139482511 splice site probably benign
R0466:Aspm UTSW 1 139477901 missense probably damaging 1.00
R0520:Aspm UTSW 1 139478820 missense possibly damaging 0.51
R0615:Aspm UTSW 1 139487289 missense probably damaging 1.00
R0626:Aspm UTSW 1 139491601 missense probably damaging 1.00
R0660:Aspm UTSW 1 139457764 missense probably benign 0.03
R0751:Aspm UTSW 1 139456898 splice site probably benign
R0830:Aspm UTSW 1 139474254 missense probably damaging 0.99
R1109:Aspm UTSW 1 139456758 missense probably damaging 0.99
R1114:Aspm UTSW 1 139461924 splice site probably benign
R1130:Aspm UTSW 1 139477834 missense possibly damaging 0.90
R1298:Aspm UTSW 1 139457419 missense probably benign 0.01
R1386:Aspm UTSW 1 139457623 missense probably benign 0.03
R1386:Aspm UTSW 1 139478972 missense possibly damaging 0.80
R1557:Aspm UTSW 1 139468668 missense probably benign 0.01
R1625:Aspm UTSW 1 139481039 missense probably benign 0.01
R1728:Aspm UTSW 1 139473574 missense probably benign
R1729:Aspm UTSW 1 139473574 missense probably benign
R1730:Aspm UTSW 1 139473574 missense probably benign
R1733:Aspm UTSW 1 139457117 missense probably benign 0.27
R1739:Aspm UTSW 1 139473574 missense probably benign
R1762:Aspm UTSW 1 139473574 missense probably benign
R1783:Aspm UTSW 1 139473574 missense probably benign
R1784:Aspm UTSW 1 139473574 missense probably benign
R1785:Aspm UTSW 1 139473574 missense probably benign
R1793:Aspm UTSW 1 139457341 missense probably benign 0.00
R1893:Aspm UTSW 1 139479867 missense probably damaging 1.00
R1911:Aspm UTSW 1 139478094 missense probably benign 0.06
R2103:Aspm UTSW 1 139491665 missense probably damaging 0.99
R2128:Aspm UTSW 1 139457635 missense probably benign 0.14
R2129:Aspm UTSW 1 139457635 missense probably benign 0.14
R2239:Aspm UTSW 1 139456846 missense possibly damaging 0.67
R2352:Aspm UTSW 1 139457562 missense probably benign 0.02
R2353:Aspm UTSW 1 139477697 missense probably damaging 1.00
R2380:Aspm UTSW 1 139479348 missense probably damaging 1.00
R2413:Aspm UTSW 1 139477757 missense probably damaging 1.00
R2421:Aspm UTSW 1 139488487 missense possibly damaging 0.49
R3607:Aspm UTSW 1 139480668 missense probably benign 0.13
R3711:Aspm UTSW 1 139458100 missense probably benign 0.17
R3718:Aspm UTSW 1 139480889 missense probably benign 0.09
R3718:Aspm UTSW 1 139490427 missense probably benign 0.31
R3741:Aspm UTSW 1 139478619 missense possibly damaging 0.47
R3788:Aspm UTSW 1 139463203 missense probably damaging 1.00
R3838:Aspm UTSW 1 139478054 missense probably benign 0.24
R3839:Aspm UTSW 1 139478054 missense probably benign 0.24
R3849:Aspm UTSW 1 139458286 missense probably benign 0.21
R4075:Aspm UTSW 1 139474285 missense probably damaging 1.00
R4080:Aspm UTSW 1 139470755 missense probably damaging 1.00
R4463:Aspm UTSW 1 139455010 missense possibly damaging 0.95
R4537:Aspm UTSW 1 139474303 missense probably benign 0.01
R4547:Aspm UTSW 1 139478187 missense possibly damaging 0.75
R4573:Aspm UTSW 1 139479507 missense probably damaging 0.98
R4680:Aspm UTSW 1 139480671 missense probably benign 0.05
R4807:Aspm UTSW 1 139477919 missense probably damaging 1.00
R4840:Aspm UTSW 1 139470531 missense possibly damaging 0.83
R4854:Aspm UTSW 1 139478072 nonsense probably null
R4859:Aspm UTSW 1 139469393 missense probably damaging 1.00
R4910:Aspm UTSW 1 139491543 missense probably damaging 1.00
R4953:Aspm UTSW 1 139471734 missense probably benign 0.00
R4974:Aspm UTSW 1 139478010 missense probably benign 0.03
R4981:Aspm UTSW 1 139470760 splice site probably null
R5082:Aspm UTSW 1 139478676 nonsense probably null
R5223:Aspm UTSW 1 139478334 missense probably damaging 1.00
R5268:Aspm UTSW 1 139464295 missense probably damaging 1.00
R5371:Aspm UTSW 1 139470541 nonsense probably null
R5377:Aspm UTSW 1 139457483 missense probably damaging 0.96
R5377:Aspm UTSW 1 139470395 splice site probably null
R5481:Aspm UTSW 1 139457061 missense possibly damaging 0.85
R5513:Aspm UTSW 1 139482398 missense probably damaging 1.00
R5578:Aspm UTSW 1 139470717 missense probably damaging 1.00
R5649:Aspm UTSW 1 139479669 missense probably benign
R5685:Aspm UTSW 1 139487288 missense probably benign 0.10
R5695:Aspm UTSW 1 139479669 missense probably benign
R5766:Aspm UTSW 1 139479002 missense probably damaging 0.99
R5964:Aspm UTSW 1 139455227 intron probably benign
R5993:Aspm UTSW 1 139479531 missense probably benign 0.28
R6027:Aspm UTSW 1 139463056 missense probably damaging 1.00
R6029:Aspm UTSW 1 139480990 missense possibly damaging 0.83
R6102:Aspm UTSW 1 139477459 nonsense probably null
R6188:Aspm UTSW 1 139479239 missense possibly damaging 0.79
R6257:Aspm UTSW 1 139482053 splice site probably null
R6433:Aspm UTSW 1 139473683 missense probably damaging 1.00
R6682:Aspm UTSW 1 139457722 missense possibly damaging 0.67
R6763:Aspm UTSW 1 139470517 missense possibly damaging 0.64
R6798:Aspm UTSW 1 139468685 missense possibly damaging 0.66
R6815:Aspm UTSW 1 139480142 missense probably benign 0.04
R6854:Aspm UTSW 1 139463182 missense possibly damaging 0.90
R6928:Aspm UTSW 1 139480206 nonsense probably null
R6943:Aspm UTSW 1 139480542 missense probably damaging 1.00
R6979:Aspm UTSW 1 139480485 missense probably damaging 1.00
R6998:Aspm UTSW 1 139469472 missense probably damaging 1.00
R7126:Aspm UTSW 1 139480803 missense probably benign 0.27
R7237:Aspm UTSW 1 139477929 missense possibly damaging 0.81
R7240:Aspm UTSW 1 139478651 nonsense probably null
R7272:Aspm UTSW 1 139458328 missense probably benign 0.14
R7427:Aspm UTSW 1 139457616 missense probably benign 0.01
R7519:Aspm UTSW 1 139490336 missense possibly damaging 0.53
R7776:Aspm UTSW 1 139479846 missense possibly damaging 0.85
R7875:Aspm UTSW 1 139455134 missense probably benign 0.02
R7883:Aspm UTSW 1 139478667 missense possibly damaging 0.47
R7964:Aspm UTSW 1 139480686 missense probably damaging 1.00
R8012:Aspm UTSW 1 139457464 missense probably benign 0.03
R8029:Aspm UTSW 1 139471632 missense probably benign 0.00
R8233:Aspm UTSW 1 139457304 missense probably benign 0.28
R8277:Aspm UTSW 1 139455010 missense probably damaging 1.00
R8345:Aspm UTSW 1 139464273 nonsense probably null
R8491:Aspm UTSW 1 139457695 missense probably damaging 0.98
R8511:Aspm UTSW 1 139457308 missense probably damaging 1.00
R8557:Aspm UTSW 1 139456756 missense probably benign 0.01
R8927:Aspm UTSW 1 139490387 nonsense probably null
R8928:Aspm UTSW 1 139490387 nonsense probably null
R8950:Aspm UTSW 1 139478952 missense probably damaging 1.00
R9033:Aspm UTSW 1 139478127 missense probably damaging 1.00
R9083:Aspm UTSW 1 139493698 missense possibly damaging 0.70
R9133:Aspm UTSW 1 139491528 missense probably damaging 1.00
R9160:Aspm UTSW 1 139490124 missense probably damaging 1.00
R9179:Aspm UTSW 1 139476715 missense probably damaging 1.00
R9265:Aspm UTSW 1 139461444 missense probably benign 0.24
R9400:Aspm UTSW 1 139479903 missense probably damaging 1.00
R9419:Aspm UTSW 1 139457185 missense probably benign 0.29
R9454:Aspm UTSW 1 139480994 missense probably benign 0.00
R9517:Aspm UTSW 1 139479429 missense probably damaging 1.00
R9524:Aspm UTSW 1 139480869 missense probably damaging 1.00
R9544:Aspm UTSW 1 139457785 missense probably benign 0.01
R9640:Aspm UTSW 1 139480272 missense possibly damaging 0.88
R9698:Aspm UTSW 1 139461908 missense probably benign 0.28
R9790:Aspm UTSW 1 139480637 missense probably damaging 0.98
R9791:Aspm UTSW 1 139480637 missense probably damaging 0.98
R9794:Aspm UTSW 1 139478742 missense probably damaging 0.99
X0063:Aspm UTSW 1 139458090 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATGTTTTGAACAGAGATGGTTTCG -3'
(R):5'- CTCTAAGGCTTCGTCGGATAGC -3'

Sequencing Primer
(F):5'- GATGGTTTCGAAAAAGATTACAACG -3'
(R):5'- CTTCGTCGGATAGCTTTGATTTC -3'
Posted On 2016-03-17