Incidental Mutation 'R4893:Acss1'
ID377375
Institutional Source Beutler Lab
Gene Symbol Acss1
Ensembl Gene ENSMUSG00000027452
Gene Nameacyl-CoA synthetase short-chain family member 1
SynonymsAcas2l, Acas2, 1110032O15Rik, AceCS2
MMRRC Submission 042498-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4893 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location150618105-150668500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 150629866 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 323 (V323F)
Ref Sequence ENSEMBL: ENSMUSP00000028944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028944]
Predicted Effect probably damaging
Transcript: ENSMUST00000028944
AA Change: V323F

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028944
Gene: ENSMUSG00000027452
AA Change: V323F

DomainStartEndE-ValueType
low complexity region 4 29 N/A INTRINSIC
Pfam:ACAS_N 51 107 8.6e-17 PFAM
Pfam:AMP-binding 108 549 2.5e-90 PFAM
Pfam:AMP-binding_C 557 635 7.9e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154328
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial acetyl-CoA synthetase enzyme. A similar protein in mice plays an important role in the tricarboxylic acid cycle by catalyzing the conversion of acetate to acetyl CoA. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice with disruptions in this gene display abnormalities in acetate metabolism. Ability to maintain body temperature under fasting conditions is reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik A G 8: 116,971,165 I401T probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adgrf3 T G 5: 30,200,478 D286A probably benign Het
Akap5 T C 12: 76,329,969 V718A probably damaging Het
Ankk1 A G 9: 49,415,683 V732A probably benign Het
Antxr2 T A 5: 98,004,072 D180V probably damaging Het
Arfgef2 T G 2: 166,866,956 F1063V probably benign Het
Ascl5 A T 1: 136,051,179 I126F probably damaging Het
Aspm T A 1: 139,489,839 probably null Het
Atf6b T C 17: 34,648,612 S100P probably damaging Het
Baz2a C A 10: 128,123,415 H1266Q possibly damaging Het
Cdh4 A T 2: 179,847,419 probably benign Het
Celsr3 C G 9: 108,849,421 S3283C probably damaging Het
Clca4b C T 3: 144,925,173 V309M possibly damaging Het
Cnbd2 T C 2: 156,365,184 Y436H probably damaging Het
Csnk1a1 T C 18: 61,585,301 probably benign Het
Cstf1 C T 2: 172,380,524 R401C probably damaging Het
Cul3 A G 1: 80,288,850 I117T probably damaging Het
Dlgap3 A G 4: 127,194,983 D124G probably damaging Het
Dnah12 A G 14: 26,710,170 D381G possibly damaging Het
Dtna T C 18: 23,569,667 L85P probably damaging Het
Ephb2 A G 4: 136,659,753 I722T probably damaging Het
Epn3 A T 11: 94,491,996 F421I probably damaging Het
Fam160b1 T A 19: 57,381,756 H477Q probably benign Het
Fam83f T A 15: 80,691,955 L269H probably damaging Het
Gata4 G A 14: 63,201,596 A139V probably benign Het
Glce T C 9: 62,068,495 D241G probably benign Het
Gm17728 A T 17: 9,422,231 I58F probably benign Het
Inhba A T 13: 16,026,549 D232V possibly damaging Het
Itgb2l C A 16: 96,427,821 R394L probably benign Het
Klhl14 T C 18: 21,557,935 Y486C probably damaging Het
Krt1 A G 15: 101,850,120 I203T probably damaging Het
Lims2 T C 18: 31,941,811 probably null Het
Lrrc31 T G 3: 30,679,297 I423L probably benign Het
Map7d1 C T 4: 126,233,222 D732N unknown Het
Mau2 A T 8: 70,030,640 probably null Het
Mbtps1 G A 8: 119,518,193 R840W probably damaging Het
Morn3 T C 5: 123,037,682 I214M probably damaging Het
Mrpl44 A G 1: 79,777,865 K63E probably damaging Het
Muc20 T C 16: 32,794,672 T112A possibly damaging Het
Myo6 T A 9: 80,228,877 L94Q probably damaging Het
Nos1 C A 5: 117,952,877 T1423K possibly damaging Het
Olfr166 A G 16: 19,486,903 T22A probably benign Het
Olfr31 T C 14: 14,328,852 V247A probably damaging Het
Pdzd2 T C 15: 12,385,343 T1114A probably benign Het
Pgm1 T C 5: 64,105,940 V310A probably benign Het
Pi4ka T C 16: 17,377,036 E166G probably benign Het
Pign A T 1: 105,646,711 D303E probably damaging Het
Pik3c3 G T 18: 30,282,000 V149L probably benign Het
Pkd1l3 A T 8: 109,638,394 Y1126F probably benign Het
Pkd2l1 T A 19: 44,153,771 Q516L probably benign Het
Pnliprp2 C A 19: 58,771,421 Q355K probably benign Het
Pnpla7 T A 2: 25,053,676 Y1314* probably null Het
Ppp1r1b A G 11: 98,355,344 T51A possibly damaging Het
Prkcd A T 14: 30,599,425 S544T probably damaging Het
Pusl1 G A 4: 155,889,541 T252I probably benign Het
Rnf44 A G 13: 54,681,932 probably null Het
Slc24a2 A T 4: 87,226,908 V303E probably damaging Het
Slc28a2 T A 2: 122,455,216 probably null Het
Sox8 T C 17: 25,568,989 D162G probably damaging Het
Spag1 T C 15: 36,197,846 probably null Het
Taar6 T C 10: 23,985,400 I83V probably benign Het
Tes T A 6: 17,104,596 C359S probably damaging Het
Vmn2r4 A T 3: 64,406,255 L435H probably damaging Het
Zfhx3 G T 8: 108,957,007 D3693Y unknown Het
Zfp931 G A 2: 178,068,203 P130L probably damaging Het
Zfr T G 15: 12,136,542 V95G unknown Het
Zw10 A G 9: 49,074,025 E587G possibly damaging Het
Other mutations in Acss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Acss1 APN 2 150619686 missense probably benign 0.27
IGL01594:Acss1 APN 2 150621530 missense probably damaging 0.98
IGL01781:Acss1 APN 2 150637872 missense probably damaging 1.00
IGL02189:Acss1 APN 2 150629868 missense probably damaging 0.98
IGL02735:Acss1 APN 2 150638467 missense probably damaging 1.00
IGL02738:Acss1 APN 2 150624872 splice site probably benign
IGL03399:Acss1 APN 2 150637878 missense probably damaging 1.00
Cutlass UTSW 2 150668131 nonsense probably null
scimitar UTSW 2 150628492 critical splice donor site probably null
R0058:Acss1 UTSW 2 150628539 missense probably damaging 0.97
R0063:Acss1 UTSW 2 150627292 missense probably damaging 1.00
R0063:Acss1 UTSW 2 150627292 missense probably damaging 1.00
R1550:Acss1 UTSW 2 150642795 missense probably damaging 0.99
R1651:Acss1 UTSW 2 150638437 missense possibly damaging 0.94
R2066:Acss1 UTSW 2 150668131 nonsense probably null
R4414:Acss1 UTSW 2 150659903 missense possibly damaging 0.58
R4559:Acss1 UTSW 2 150638485 missense probably benign 0.19
R6408:Acss1 UTSW 2 150628492 critical splice donor site probably null
R6459:Acss1 UTSW 2 150667920 missense probably damaging 0.97
R7593:Acss1 UTSW 2 150619768 nonsense probably null
R7598:Acss1 UTSW 2 150638450 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AACTGTCCCCTTGCCAGATG -3'
(R):5'- TCTGTGGAAAACCTCTGCAG -3'

Sequencing Primer
(F):5'- CAGATGCAAGCCTCCAGG -3'
(R):5'- GTGGAAAACCTCTGCAGCCATC -3'
Posted On2016-03-17