Incidental Mutation 'R4893:Antxr2'
ID377394
Institutional Source Beutler Lab
Gene Symbol Antxr2
Ensembl Gene ENSMUSG00000029338
Gene Nameanthrax toxin receptor 2
Synonyms2310046B19Rik, CMG2, CMG-2, cI-35
MMRRC Submission 042498-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R4893 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location97882783-98031043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98004072 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 180 (D180V)
Ref Sequence ENSEMBL: ENSMUSP00000142605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031281] [ENSMUST00000199088]
Predicted Effect probably damaging
Transcript: ENSMUST00000031281
AA Change: D180V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031281
Gene: ENSMUSG00000029338
AA Change: D180V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
VWA 42 214 2.86e-18 SMART
Pfam:Anth_Ig 215 317 4e-38 PFAM
transmembrane domain 319 341 N/A INTRINSIC
low complexity region 352 369 N/A INTRINSIC
Pfam:Ant_C 394 485 7.4e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199088
AA Change: D180V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142605
Gene: ENSMUSG00000029338
AA Change: D180V

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
VWA 42 214 1.7e-20 SMART
transmembrane domain 319 341 N/A INTRINSIC
low complexity region 352 369 N/A INTRINSIC
Pfam:Ant_C 394 483 1.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199517
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for anthrax toxin. The protein binds to collagen IV and laminin, suggesting that it may be involved in extracellular matrix adhesion. Mutations in this gene cause juvenile hyaline fibromatosis and infantile systemic hyalinosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for null mutations display female infertility. Mice homozygous for one allele are highly resistant to Bacillus anthracis or anthrax toxin induced lethality. Young mice homozygous for a second allele display pregnancy-related premature death and failure of parturition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik A G 8: 116,971,165 I401T probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Acss1 C A 2: 150,629,866 V323F probably damaging Het
Adgrf3 T G 5: 30,200,478 D286A probably benign Het
Akap5 T C 12: 76,329,969 V718A probably damaging Het
Ankk1 A G 9: 49,415,683 V732A probably benign Het
Arfgef2 T G 2: 166,866,956 F1063V probably benign Het
Ascl5 A T 1: 136,051,179 I126F probably damaging Het
Aspm T A 1: 139,489,839 probably null Het
Atf6b T C 17: 34,648,612 S100P probably damaging Het
Baz2a C A 10: 128,123,415 H1266Q possibly damaging Het
Cdh4 A T 2: 179,847,419 probably benign Het
Celsr3 C G 9: 108,849,421 S3283C probably damaging Het
Clca4b C T 3: 144,925,173 V309M possibly damaging Het
Cnbd2 T C 2: 156,365,184 Y436H probably damaging Het
Csnk1a1 T C 18: 61,585,301 probably benign Het
Cstf1 C T 2: 172,380,524 R401C probably damaging Het
Cul3 A G 1: 80,288,850 I117T probably damaging Het
Dlgap3 A G 4: 127,194,983 D124G probably damaging Het
Dnah12 A G 14: 26,710,170 D381G possibly damaging Het
Dtna T C 18: 23,569,667 L85P probably damaging Het
Ephb2 A G 4: 136,659,753 I722T probably damaging Het
Epn3 A T 11: 94,491,996 F421I probably damaging Het
Fam160b1 T A 19: 57,381,756 H477Q probably benign Het
Fam83f T A 15: 80,691,955 L269H probably damaging Het
Gata4 G A 14: 63,201,596 A139V probably benign Het
Glce T C 9: 62,068,495 D241G probably benign Het
Gm17728 A T 17: 9,422,231 I58F probably benign Het
Inhba A T 13: 16,026,549 D232V possibly damaging Het
Itgb2l C A 16: 96,427,821 R394L probably benign Het
Klhl14 T C 18: 21,557,935 Y486C probably damaging Het
Krt1 A G 15: 101,850,120 I203T probably damaging Het
Lims2 T C 18: 31,941,811 probably null Het
Lrrc31 T G 3: 30,679,297 I423L probably benign Het
Map7d1 C T 4: 126,233,222 D732N unknown Het
Mau2 A T 8: 70,030,640 probably null Het
Mbtps1 G A 8: 119,518,193 R840W probably damaging Het
Morn3 T C 5: 123,037,682 I214M probably damaging Het
Mrpl44 A G 1: 79,777,865 K63E probably damaging Het
Muc20 T C 16: 32,794,672 T112A possibly damaging Het
Myo6 T A 9: 80,228,877 L94Q probably damaging Het
Nos1 C A 5: 117,952,877 T1423K possibly damaging Het
Olfr166 A G 16: 19,486,903 T22A probably benign Het
Olfr31 T C 14: 14,328,852 V247A probably damaging Het
Pdzd2 T C 15: 12,385,343 T1114A probably benign Het
Pgm1 T C 5: 64,105,940 V310A probably benign Het
Pi4ka T C 16: 17,377,036 E166G probably benign Het
Pign A T 1: 105,646,711 D303E probably damaging Het
Pik3c3 G T 18: 30,282,000 V149L probably benign Het
Pkd1l3 A T 8: 109,638,394 Y1126F probably benign Het
Pkd2l1 T A 19: 44,153,771 Q516L probably benign Het
Pnliprp2 C A 19: 58,771,421 Q355K probably benign Het
Pnpla7 T A 2: 25,053,676 Y1314* probably null Het
Ppp1r1b A G 11: 98,355,344 T51A possibly damaging Het
Prkcd A T 14: 30,599,425 S544T probably damaging Het
Pusl1 G A 4: 155,889,541 T252I probably benign Het
Rnf44 A G 13: 54,681,932 probably null Het
Slc24a2 A T 4: 87,226,908 V303E probably damaging Het
Slc28a2 T A 2: 122,455,216 probably null Het
Sox8 T C 17: 25,568,989 D162G probably damaging Het
Spag1 T C 15: 36,197,846 probably null Het
Taar6 T C 10: 23,985,400 I83V probably benign Het
Tes T A 6: 17,104,596 C359S probably damaging Het
Vmn2r4 A T 3: 64,406,255 L435H probably damaging Het
Zfhx3 G T 8: 108,957,007 D3693Y unknown Het
Zfp931 G A 2: 178,068,203 P130L probably damaging Het
Zfr T G 15: 12,136,542 V95G unknown Het
Zw10 A G 9: 49,074,025 E587G possibly damaging Het
Other mutations in Antxr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Antxr2 APN 5 97886607 splice site probably benign
IGL00661:Antxr2 APN 5 98004296 missense probably benign 0.26
IGL01105:Antxr2 APN 5 98004943 splice site probably benign
IGL01472:Antxr2 APN 5 98027499 missense probably benign 0.00
IGL01719:Antxr2 APN 5 97948273 missense possibly damaging 0.82
IGL02184:Antxr2 APN 5 97977595 splice site probably null
IGL02199:Antxr2 APN 5 97977595 splice site probably null
IGL02250:Antxr2 APN 5 97977595 splice site probably null
IGL02251:Antxr2 APN 5 97977595 splice site probably null
IGL02368:Antxr2 APN 5 97949198 missense probably damaging 1.00
IGL02447:Antxr2 APN 5 98030408 missense possibly damaging 0.61
IGL02740:Antxr2 APN 5 98030392 splice site probably benign
IGL02850:Antxr2 APN 5 98004078 missense probably damaging 1.00
IGL02867:Antxr2 APN 5 97977650 missense probably benign 0.00
IGL02889:Antxr2 APN 5 97977650 missense probably benign 0.00
R0013:Antxr2 UTSW 5 97979985 missense probably damaging 0.98
R0040:Antxr2 UTSW 5 97938425 missense possibly damaging 0.74
R0040:Antxr2 UTSW 5 97938425 missense possibly damaging 0.74
R0069:Antxr2 UTSW 5 97948250 missense possibly damaging 0.95
R0184:Antxr2 UTSW 5 97980030 missense probably damaging 1.00
R0367:Antxr2 UTSW 5 98029596 missense probably benign 0.01
R0638:Antxr2 UTSW 5 97960637 nonsense probably null
R0732:Antxr2 UTSW 5 97960708 splice site probably null
R1255:Antxr2 UTSW 5 97975372 missense probably benign 0.39
R1471:Antxr2 UTSW 5 97975340 missense possibly damaging 0.88
R1520:Antxr2 UTSW 5 97960692 missense probably benign 0.38
R1660:Antxr2 UTSW 5 97975350 nonsense probably null
R1870:Antxr2 UTSW 5 98030438 missense probably damaging 1.00
R2969:Antxr2 UTSW 5 98030416 nonsense probably null
R3547:Antxr2 UTSW 5 97977657 missense probably benign 0.09
R4237:Antxr2 UTSW 5 97938407 missense probably damaging 1.00
R4660:Antxr2 UTSW 5 98004054 critical splice donor site probably null
R4702:Antxr2 UTSW 5 97949169 critical splice donor site probably null
R4997:Antxr2 UTSW 5 97977694 missense probably benign 0.04
R5388:Antxr2 UTSW 5 97977599 critical splice donor site probably null
R5604:Antxr2 UTSW 5 97948310 missense probably damaging 0.98
R6093:Antxr2 UTSW 5 98030460 missense probably damaging 0.99
R6118:Antxr2 UTSW 5 97949201 missense probably damaging 1.00
R6130:Antxr2 UTSW 5 98004272 missense possibly damaging 0.89
R6139:Antxr2 UTSW 5 97977706 splice site probably null
R6992:Antxr2 UTSW 5 97960705 missense probably benign 0.09
R8127:Antxr2 UTSW 5 97980017 nonsense probably null
R8267:Antxr2 UTSW 5 97965762 critical splice acceptor site probably null
R8301:Antxr2 UTSW 5 97977679 missense probably benign 0.20
R8324:Antxr2 UTSW 5 97938509 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACCATTGTCTCACTGATTAAGG -3'
(R):5'- GTGAAGCTGTCTACACACCCAG -3'

Sequencing Primer
(F):5'- CATTGTCTCACTGATTAAGGTAAAGG -3'
(R):5'- ACACCCAGTGTTGCGTCTG -3'
Posted On2016-03-17