Incidental Mutation 'R4893:Akap5'
ID377422
Institutional Source Beutler Lab
Gene Symbol Akap5
Ensembl Gene ENSMUSG00000021057
Gene NameA kinase (PRKA) anchor protein 5
SynonymsLOC238276, AKAP150, 3526401B18Rik
MMRRC Submission 042498-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R4893 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location76324891-76334153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76329969 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 718 (V718A)
Ref Sequence ENSEMBL: ENSMUSP00000114495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095610] [ENSMUST00000154078] [ENSMUST00000172992]
Predicted Effect probably damaging
Transcript: ENSMUST00000095610
AA Change: V725A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093270
Gene: ENSMUSG00000021057
AA Change: V725A

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
Pfam:WSK 78 108 4.7e-13 PFAM
SCOP:d1k28a2 386 573 6e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154078
AA Change: V718A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114495
Gene: ENSMUSG00000021057
AA Change: V718A

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
Pfam:WSK 71 101 3.3e-13 PFAM
SCOP:d1k28a2 379 566 8e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172992
AA Change: V725A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134127
Gene: ENSMUSG00000021057
AA Change: V725A

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
Pfam:WSK 79 107 8.7e-15 PFAM
SCOP:d1k28a2 386 573 6e-21 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein binds to the RII-beta regulatory subunit of PKA, and also to protein kinase C and the phosphatase calcineurin. It is predominantly expressed in cerebral cortex and may anchor the PKA protein at postsynaptic densities (PSD) and be involved in the regulation of postsynaptic events. It is also expressed in T lymphocytes and may function to inhibit interleukin-2 transcription by disrupting calcineurin-dependent dephosphorylation of NFAT. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced long term potentiation, improved glucose handling and heightened insulin sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik A G 8: 116,971,165 I401T probably damaging Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
Acss1 C A 2: 150,629,866 V323F probably damaging Het
Adgrf3 T G 5: 30,200,478 D286A probably benign Het
Ankk1 A G 9: 49,415,683 V732A probably benign Het
Antxr2 T A 5: 98,004,072 D180V probably damaging Het
Arfgef2 T G 2: 166,866,956 F1063V probably benign Het
Ascl5 A T 1: 136,051,179 I126F probably damaging Het
Aspm T A 1: 139,489,839 probably null Het
Atf6b T C 17: 34,648,612 S100P probably damaging Het
Baz2a C A 10: 128,123,415 H1266Q possibly damaging Het
Cdh4 A T 2: 179,847,419 probably benign Het
Celsr3 C G 9: 108,849,421 S3283C probably damaging Het
Clca4b C T 3: 144,925,173 V309M possibly damaging Het
Cnbd2 T C 2: 156,365,184 Y436H probably damaging Het
Csnk1a1 T C 18: 61,585,301 probably benign Het
Cstf1 C T 2: 172,380,524 R401C probably damaging Het
Cul3 A G 1: 80,288,850 I117T probably damaging Het
Dlgap3 A G 4: 127,194,983 D124G probably damaging Het
Dnah12 A G 14: 26,710,170 D381G possibly damaging Het
Dtna T C 18: 23,569,667 L85P probably damaging Het
Ephb2 A G 4: 136,659,753 I722T probably damaging Het
Epn3 A T 11: 94,491,996 F421I probably damaging Het
Fam160b1 T A 19: 57,381,756 H477Q probably benign Het
Fam83f T A 15: 80,691,955 L269H probably damaging Het
Gata4 G A 14: 63,201,596 A139V probably benign Het
Glce T C 9: 62,068,495 D241G probably benign Het
Gm17728 A T 17: 9,422,231 I58F probably benign Het
Inhba A T 13: 16,026,549 D232V possibly damaging Het
Itgb2l C A 16: 96,427,821 R394L probably benign Het
Klhl14 T C 18: 21,557,935 Y486C probably damaging Het
Krt1 A G 15: 101,850,120 I203T probably damaging Het
Lims2 T C 18: 31,941,811 probably null Het
Lrrc31 T G 3: 30,679,297 I423L probably benign Het
Map7d1 C T 4: 126,233,222 D732N unknown Het
Mau2 A T 8: 70,030,640 probably null Het
Mbtps1 G A 8: 119,518,193 R840W probably damaging Het
Morn3 T C 5: 123,037,682 I214M probably damaging Het
Mrpl44 A G 1: 79,777,865 K63E probably damaging Het
Muc20 T C 16: 32,794,672 T112A possibly damaging Het
Myo6 T A 9: 80,228,877 L94Q probably damaging Het
Nos1 C A 5: 117,952,877 T1423K possibly damaging Het
Olfr166 A G 16: 19,486,903 T22A probably benign Het
Olfr31 T C 14: 14,328,852 V247A probably damaging Het
Pdzd2 T C 15: 12,385,343 T1114A probably benign Het
Pgm1 T C 5: 64,105,940 V310A probably benign Het
Pi4ka T C 16: 17,377,036 E166G probably benign Het
Pign A T 1: 105,646,711 D303E probably damaging Het
Pik3c3 G T 18: 30,282,000 V149L probably benign Het
Pkd1l3 A T 8: 109,638,394 Y1126F probably benign Het
Pkd2l1 T A 19: 44,153,771 Q516L probably benign Het
Pnliprp2 C A 19: 58,771,421 Q355K probably benign Het
Pnpla7 T A 2: 25,053,676 Y1314* probably null Het
Ppp1r1b A G 11: 98,355,344 T51A possibly damaging Het
Prkcd A T 14: 30,599,425 S544T probably damaging Het
Pusl1 G A 4: 155,889,541 T252I probably benign Het
Rnf44 A G 13: 54,681,932 probably null Het
Slc24a2 A T 4: 87,226,908 V303E probably damaging Het
Slc28a2 T A 2: 122,455,216 probably null Het
Sox8 T C 17: 25,568,989 D162G probably damaging Het
Spag1 T C 15: 36,197,846 probably null Het
Taar6 T C 10: 23,985,400 I83V probably benign Het
Tes T A 6: 17,104,596 C359S probably damaging Het
Vmn2r4 A T 3: 64,406,255 L435H probably damaging Het
Zfhx3 G T 8: 108,957,007 D3693Y unknown Het
Zfp931 G A 2: 178,068,203 P130L probably damaging Het
Zfr T G 15: 12,136,542 V95G unknown Het
Zw10 A G 9: 49,074,025 E587G possibly damaging Het
Other mutations in Akap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02194:Akap5 APN 12 76328033 missense probably damaging 0.99
IGL02309:Akap5 APN 12 76328855 missense possibly damaging 0.91
IGL02801:Akap5 APN 12 76328995 missense probably benign 0.25
IGL03136:Akap5 APN 12 76329875 nonsense probably null
PIT4802001:Akap5 UTSW 12 76329932 missense probably damaging 1.00
R1517:Akap5 UTSW 12 76329262 missense possibly damaging 0.91
R1694:Akap5 UTSW 12 76329924 missense probably damaging 0.99
R2012:Akap5 UTSW 12 76329348 missense possibly damaging 0.53
R4507:Akap5 UTSW 12 76327907 missense possibly damaging 0.91
R4755:Akap5 UTSW 12 76327807 nonsense probably null
R4905:Akap5 UTSW 12 76328433 missense probably damaging 0.96
R5482:Akap5 UTSW 12 76328826 missense probably benign 0.26
R5886:Akap5 UTSW 12 76327845 missense possibly damaging 0.88
R7151:Akap5 UTSW 12 76328249 missense probably benign 0.08
R7413:Akap5 UTSW 12 76328904 missense possibly damaging 0.65
R7514:Akap5 UTSW 12 76328529 missense probably benign 0.00
X0067:Akap5 UTSW 12 76328198 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CAAACGAATGGAGCCAATTGC -3'
(R):5'- GCTGGAACTGTACCCTTAGATTC -3'

Sequencing Primer
(F):5'- TCAATGGAAAACGAGCAAGT -3'
(R):5'- TGGAACTGTACCCTTAGATTCCACAG -3'
Posted On2016-03-17