Incidental Mutation 'R4893:Prkcd'
ID377426
Institutional Source Beutler Lab
Gene Symbol Prkcd
Ensembl Gene ENSMUSG00000021948
Gene Nameprotein kinase C, delta
SynonymsPkcd, D14Ertd420e, PKC[d], PKCdelta
MMRRC Submission 042498-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.630) question?
Stock #R4893 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location30595354-30626210 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30599425 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 544 (S544T)
Ref Sequence ENSEMBL: ENSMUSP00000107829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022521] [ENSMUST00000112202] [ENSMUST00000112203] [ENSMUST00000112206] [ENSMUST00000112207] [ENSMUST00000112210] [ENSMUST00000112211]
Predicted Effect probably benign
Transcript: ENSMUST00000022521
AA Change: S570T

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022521
Gene: ENSMUSG00000021948
AA Change: S570T

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 373 627 1.17e-97 SMART
S_TK_X 628 691 8.92e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112202
AA Change: S455T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107821
Gene: ENSMUSG00000021948
AA Change: S455T

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 258 512 1.17e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112203
AA Change: S429T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107822
Gene: ENSMUSG00000021948
AA Change: S429T

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 232 486 1.17e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112206
AA Change: S455T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107825
Gene: ENSMUSG00000021948
AA Change: S455T

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 258 512 1.17e-97 SMART
S_TK_X 513 576 8.92e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112207
AA Change: S429T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107826
Gene: ENSMUSG00000021948
AA Change: S429T

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 232 486 1.17e-97 SMART
S_TK_X 487 550 8.92e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112208
AA Change: S544T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107827
Gene: ENSMUSG00000021948
AA Change: S544T

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 347 601 1.17e-97 SMART
S_TK_X 602 665 8.92e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112210
AA Change: S544T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107829
Gene: ENSMUSG00000021948
AA Change: S544T

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 347 601 1.17e-97 SMART
S_TK_X 602 665 8.92e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112211
AA Change: S570T

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107830
Gene: ENSMUSG00000021948
AA Change: S570T

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 373 627 1.17e-97 SMART
S_TK_X 628 691 8.92e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145806
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. Studies both in human and mice demonstrate that this kinase is involved in B cell signaling and in the regulation of growth, apoptosis, and differentiation of a variety of cell types. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased neutrophil cell numbers and activity, increased B cell numbers and proliferation, increased acute inflammation, and increased IgG1 and IgA serum levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik A G 8: 116,971,165 I401T probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Acss1 C A 2: 150,629,866 V323F probably damaging Het
Adgrf3 T G 5: 30,200,478 D286A probably benign Het
Akap5 T C 12: 76,329,969 V718A probably damaging Het
Ankk1 A G 9: 49,415,683 V732A probably benign Het
Antxr2 T A 5: 98,004,072 D180V probably damaging Het
Arfgef2 T G 2: 166,866,956 F1063V probably benign Het
Ascl5 A T 1: 136,051,179 I126F probably damaging Het
Aspm T A 1: 139,489,839 probably null Het
Atf6b T C 17: 34,648,612 S100P probably damaging Het
Baz2a C A 10: 128,123,415 H1266Q possibly damaging Het
Cdh4 A T 2: 179,847,419 probably benign Het
Celsr3 C G 9: 108,849,421 S3283C probably damaging Het
Clca4b C T 3: 144,925,173 V309M possibly damaging Het
Cnbd2 T C 2: 156,365,184 Y436H probably damaging Het
Csnk1a1 T C 18: 61,585,301 probably benign Het
Cstf1 C T 2: 172,380,524 R401C probably damaging Het
Cul3 A G 1: 80,288,850 I117T probably damaging Het
Dlgap3 A G 4: 127,194,983 D124G probably damaging Het
Dnah12 A G 14: 26,710,170 D381G possibly damaging Het
Dtna T C 18: 23,569,667 L85P probably damaging Het
Ephb2 A G 4: 136,659,753 I722T probably damaging Het
Epn3 A T 11: 94,491,996 F421I probably damaging Het
Fam160b1 T A 19: 57,381,756 H477Q probably benign Het
Fam83f T A 15: 80,691,955 L269H probably damaging Het
Gata4 G A 14: 63,201,596 A139V probably benign Het
Glce T C 9: 62,068,495 D241G probably benign Het
Gm17728 A T 17: 9,422,231 I58F probably benign Het
Inhba A T 13: 16,026,549 D232V possibly damaging Het
Itgb2l C A 16: 96,427,821 R394L probably benign Het
Klhl14 T C 18: 21,557,935 Y486C probably damaging Het
Krt1 A G 15: 101,850,120 I203T probably damaging Het
Lims2 T C 18: 31,941,811 probably null Het
Lrrc31 T G 3: 30,679,297 I423L probably benign Het
Map7d1 C T 4: 126,233,222 D732N unknown Het
Mau2 A T 8: 70,030,640 probably null Het
Mbtps1 G A 8: 119,518,193 R840W probably damaging Het
Morn3 T C 5: 123,037,682 I214M probably damaging Het
Mrpl44 A G 1: 79,777,865 K63E probably damaging Het
Muc20 T C 16: 32,794,672 T112A possibly damaging Het
Myo6 T A 9: 80,228,877 L94Q probably damaging Het
Nos1 C A 5: 117,952,877 T1423K possibly damaging Het
Olfr166 A G 16: 19,486,903 T22A probably benign Het
Olfr31 T C 14: 14,328,852 V247A probably damaging Het
Pdzd2 T C 15: 12,385,343 T1114A probably benign Het
Pgm1 T C 5: 64,105,940 V310A probably benign Het
Pi4ka T C 16: 17,377,036 E166G probably benign Het
Pign A T 1: 105,646,711 D303E probably damaging Het
Pik3c3 G T 18: 30,282,000 V149L probably benign Het
Pkd1l3 A T 8: 109,638,394 Y1126F probably benign Het
Pkd2l1 T A 19: 44,153,771 Q516L probably benign Het
Pnliprp2 C A 19: 58,771,421 Q355K probably benign Het
Pnpla7 T A 2: 25,053,676 Y1314* probably null Het
Ppp1r1b A G 11: 98,355,344 T51A possibly damaging Het
Pusl1 G A 4: 155,889,541 T252I probably benign Het
Rnf44 A G 13: 54,681,932 probably null Het
Slc24a2 A T 4: 87,226,908 V303E probably damaging Het
Slc28a2 T A 2: 122,455,216 probably null Het
Sox8 T C 17: 25,568,989 D162G probably damaging Het
Spag1 T C 15: 36,197,846 probably null Het
Taar6 T C 10: 23,985,400 I83V probably benign Het
Tes T A 6: 17,104,596 C359S probably damaging Het
Vmn2r4 A T 3: 64,406,255 L435H probably damaging Het
Zfhx3 G T 8: 108,957,007 D3693Y unknown Het
Zfp931 G A 2: 178,068,203 P130L probably damaging Het
Zfr T G 15: 12,136,542 V95G unknown Het
Zw10 A G 9: 49,074,025 E587G possibly damaging Het
Other mutations in Prkcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Prkcd APN 14 30602422 splice site probably benign
IGL00715:Prkcd APN 14 30596003 missense probably damaging 1.00
IGL01914:Prkcd APN 14 30607426 missense possibly damaging 0.49
IGL02177:Prkcd APN 14 30605887 missense probably damaging 1.00
IGL02547:Prkcd APN 14 30599469 missense probably damaging 1.00
IGL02681:Prkcd APN 14 30601233 critical splice acceptor site probably null
Rigged UTSW 14 30610301 start codon destroyed probably null 0.99
rigged2 UTSW 14 30599743 missense probably damaging 1.00
IGL03014:Prkcd UTSW 14 30607337 missense probably damaging 1.00
R0240:Prkcd UTSW 14 30602088 missense probably damaging 0.97
R0240:Prkcd UTSW 14 30602088 missense probably damaging 0.97
R1385:Prkcd UTSW 14 30607405 missense probably damaging 1.00
R1567:Prkcd UTSW 14 30607448 missense probably benign 0.35
R2114:Prkcd UTSW 14 30605851 missense probably damaging 1.00
R2983:Prkcd UTSW 14 30599478 missense probably damaging 1.00
R3716:Prkcd UTSW 14 30599712 missense probably benign 0.00
R4162:Prkcd UTSW 14 30601197 missense probably damaging 0.98
R4164:Prkcd UTSW 14 30601197 missense probably damaging 0.98
R4180:Prkcd UTSW 14 30610304 utr 5 prime probably benign
R4637:Prkcd UTSW 14 30598765 missense probably benign 0.00
R4750:Prkcd UTSW 14 30610301 start codon destroyed probably null 0.99
R4756:Prkcd UTSW 14 30599666 missense probably benign 0.00
R4849:Prkcd UTSW 14 30599743 missense probably damaging 1.00
R4850:Prkcd UTSW 14 30599743 missense probably damaging 1.00
R4914:Prkcd UTSW 14 30605438 critical splice donor site probably null
R4925:Prkcd UTSW 14 30607613 missense probably damaging 0.98
R5644:Prkcd UTSW 14 30607413 missense probably benign 0.06
R5832:Prkcd UTSW 14 30605821 missense probably damaging 0.99
R5910:Prkcd UTSW 14 30595981 missense probably benign 0.01
R6049:Prkcd UTSW 14 30607297 missense possibly damaging 0.95
R6322:Prkcd UTSW 14 30599663 missense probably damaging 1.00
R7177:Prkcd UTSW 14 30599707 missense probably damaging 1.00
R7358:Prkcd UTSW 14 30605836 missense probably benign
R7494:Prkcd UTSW 14 30609193 missense probably benign 0.00
R7554:Prkcd UTSW 14 30609263 missense probably damaging 0.96
R7778:Prkcd UTSW 14 30605815 critical splice donor site probably null
R7810:Prkcd UTSW 14 30598450 splice site probably null
R8020:Prkcd UTSW 14 30609244 missense possibly damaging 0.58
R8145:Prkcd UTSW 14 30602062 missense probably benign 0.03
R8417:Prkcd UTSW 14 30609251 missense probably benign 0.36
Z1176:Prkcd UTSW 14 30610249 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TTCAAAAGGACTGCCTGGGAAC -3'
(R):5'- CAGCTATGCTTTTGGCCTTG -3'

Sequencing Primer
(F):5'- CAAGGCTTGGGATATGTCAGGC -3'
(R):5'- CCTTGGGTGGGTAGAACCAG -3'
Posted On2016-03-17