Incidental Mutation 'R4893:Gata4'
ID377427
Institutional Source Beutler Lab
Gene Symbol Gata4
Ensembl Gene ENSMUSG00000021944
Gene NameGATA binding protein 4
SynonymsGata-4
MMRRC Submission 042498-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4893 (G1)
Quality Score101
Status Not validated
Chromosome14
Chromosomal Location63198922-63271692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 63201596 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 139 (A139V)
Ref Sequence ENSEMBL: ENSMUSP00000113451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067417] [ENSMUST00000118022] [ENSMUST00000121312]
Predicted Effect probably benign
Transcript: ENSMUST00000067417
AA Change: A345V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000066927
Gene: ENSMUSG00000021944
AA Change: A345V

DomainStartEndE-ValueType
Pfam:GATA-N 1 204 2.2e-54 PFAM
ZnF_GATA 211 261 4.36e-18 SMART
ZnF_GATA 265 315 1.02e-23 SMART
low complexity region 342 360 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118022
AA Change: A344V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113891
Gene: ENSMUSG00000021944
AA Change: A344V

DomainStartEndE-ValueType
Pfam:GATA-N 1 207 7.8e-54 PFAM
ZnF_GATA 210 260 4.36e-18 SMART
ZnF_GATA 264 314 1.02e-23 SMART
low complexity region 341 359 N/A INTRINSIC
low complexity region 372 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121312
AA Change: A139V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113451
Gene: ENSMUSG00000021944
AA Change: A139V

DomainStartEndE-ValueType
ZnF_GATA 5 55 4.36e-18 SMART
ZnF_GATA 59 109 1.02e-23 SMART
low complexity region 136 154 N/A INTRINSIC
low complexity region 167 184 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GATA family of zinc-finger transcription factors. Members of this family recognize the GATA motif which is present in the promoters of many genes. This protein is thought to regulate genes involved in embryogenesis and in myocardial differentiation and function, and is necessary for normal testicular development. Mutations in this gene have been associated with cardiac septal defects. Additionally, alterations in gene expression have been associated with several cancer types. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in ventral morphogenesis, lack a primitive heart tube and foregut, develop partially outside the yolk sac, and die by midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik A G 8: 116,971,165 I401T probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Acss1 C A 2: 150,629,866 V323F probably damaging Het
Adgrf3 T G 5: 30,200,478 D286A probably benign Het
Akap5 T C 12: 76,329,969 V718A probably damaging Het
Ankk1 A G 9: 49,415,683 V732A probably benign Het
Antxr2 T A 5: 98,004,072 D180V probably damaging Het
Arfgef2 T G 2: 166,866,956 F1063V probably benign Het
Ascl5 A T 1: 136,051,179 I126F probably damaging Het
Aspm T A 1: 139,489,839 probably null Het
Atf6b T C 17: 34,648,612 S100P probably damaging Het
Baz2a C A 10: 128,123,415 H1266Q possibly damaging Het
Cdh4 A T 2: 179,847,419 probably benign Het
Celsr3 C G 9: 108,849,421 S3283C probably damaging Het
Clca4b C T 3: 144,925,173 V309M possibly damaging Het
Cnbd2 T C 2: 156,365,184 Y436H probably damaging Het
Csnk1a1 T C 18: 61,585,301 probably benign Het
Cstf1 C T 2: 172,380,524 R401C probably damaging Het
Cul3 A G 1: 80,288,850 I117T probably damaging Het
Dlgap3 A G 4: 127,194,983 D124G probably damaging Het
Dnah12 A G 14: 26,710,170 D381G possibly damaging Het
Dtna T C 18: 23,569,667 L85P probably damaging Het
Ephb2 A G 4: 136,659,753 I722T probably damaging Het
Epn3 A T 11: 94,491,996 F421I probably damaging Het
Fam160b1 T A 19: 57,381,756 H477Q probably benign Het
Fam83f T A 15: 80,691,955 L269H probably damaging Het
Glce T C 9: 62,068,495 D241G probably benign Het
Gm17728 A T 17: 9,422,231 I58F probably benign Het
Inhba A T 13: 16,026,549 D232V possibly damaging Het
Itgb2l C A 16: 96,427,821 R394L probably benign Het
Klhl14 T C 18: 21,557,935 Y486C probably damaging Het
Krt1 A G 15: 101,850,120 I203T probably damaging Het
Lims2 T C 18: 31,941,811 probably null Het
Lrrc31 T G 3: 30,679,297 I423L probably benign Het
Map7d1 C T 4: 126,233,222 D732N unknown Het
Mau2 A T 8: 70,030,640 probably null Het
Mbtps1 G A 8: 119,518,193 R840W probably damaging Het
Morn3 T C 5: 123,037,682 I214M probably damaging Het
Mrpl44 A G 1: 79,777,865 K63E probably damaging Het
Muc20 T C 16: 32,794,672 T112A possibly damaging Het
Myo6 T A 9: 80,228,877 L94Q probably damaging Het
Nos1 C A 5: 117,952,877 T1423K possibly damaging Het
Olfr166 A G 16: 19,486,903 T22A probably benign Het
Olfr31 T C 14: 14,328,852 V247A probably damaging Het
Pdzd2 T C 15: 12,385,343 T1114A probably benign Het
Pgm1 T C 5: 64,105,940 V310A probably benign Het
Pi4ka T C 16: 17,377,036 E166G probably benign Het
Pign A T 1: 105,646,711 D303E probably damaging Het
Pik3c3 G T 18: 30,282,000 V149L probably benign Het
Pkd1l3 A T 8: 109,638,394 Y1126F probably benign Het
Pkd2l1 T A 19: 44,153,771 Q516L probably benign Het
Pnliprp2 C A 19: 58,771,421 Q355K probably benign Het
Pnpla7 T A 2: 25,053,676 Y1314* probably null Het
Ppp1r1b A G 11: 98,355,344 T51A possibly damaging Het
Prkcd A T 14: 30,599,425 S544T probably damaging Het
Pusl1 G A 4: 155,889,541 T252I probably benign Het
Rnf44 A G 13: 54,681,932 probably null Het
Slc24a2 A T 4: 87,226,908 V303E probably damaging Het
Slc28a2 T A 2: 122,455,216 probably null Het
Sox8 T C 17: 25,568,989 D162G probably damaging Het
Spag1 T C 15: 36,197,846 probably null Het
Taar6 T C 10: 23,985,400 I83V probably benign Het
Tes T A 6: 17,104,596 C359S probably damaging Het
Vmn2r4 A T 3: 64,406,255 L435H probably damaging Het
Zfhx3 G T 8: 108,957,007 D3693Y unknown Het
Zfp931 G A 2: 178,068,203 P130L probably damaging Het
Zfr T G 15: 12,136,542 V95G unknown Het
Zw10 A G 9: 49,074,025 E587G possibly damaging Het
Other mutations in Gata4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Gata4 APN 14 63200463 missense possibly damaging 0.53
IGL02481:Gata4 APN 14 63200461 missense probably benign 0.01
IGL02483:Gata4 APN 14 63200461 missense probably benign 0.01
IGL02643:Gata4 APN 14 63204755 missense possibly damaging 0.85
R0034:Gata4 UTSW 14 63201484 missense probably benign 0.00
R0043:Gata4 UTSW 14 63203301 splice site probably benign
R1131:Gata4 UTSW 14 63204740 missense possibly damaging 0.71
R1880:Gata4 UTSW 14 63204695 missense probably damaging 1.00
R3500:Gata4 UTSW 14 63200533 missense possibly damaging 0.84
R3949:Gata4 UTSW 14 63240697 missense possibly damaging 0.95
R4976:Gata4 UTSW 14 63203689 missense probably damaging 1.00
R5152:Gata4 UTSW 14 63241121 missense probably damaging 1.00
R5198:Gata4 UTSW 14 63200451 missense probably benign 0.09
R5237:Gata4 UTSW 14 63240626 missense probably benign 0.28
R5291:Gata4 UTSW 14 63240599 missense probably damaging 0.98
R5358:Gata4 UTSW 14 63240626 missense probably benign 0.28
R5693:Gata4 UTSW 14 63241145 missense probably damaging 1.00
R7143:Gata4 UTSW 14 63204617 missense probably damaging 1.00
R7299:Gata4 UTSW 14 63203742 missense probably damaging 1.00
R7729:Gata4 UTSW 14 63240737 missense probably benign 0.00
R7849:Gata4 UTSW 14 63204725 missense possibly damaging 0.92
R8186:Gata4 UTSW 14 63201513 missense probably benign 0.00
R8673:Gata4 UTSW 14 63240809 missense probably benign 0.00
Z1177:Gata4 UTSW 14 63200382 missense probably damaging 0.99
Z1177:Gata4 UTSW 14 63241265 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACAAGAGGTACCAAGGGCTC -3'
(R):5'- GAAGGTAAAATGGTCTCCTTGGG -3'

Sequencing Primer
(F):5'- ATAGCTTAGGGCCAGTCTACAGC -3'
(R):5'- GGATTTTGATGCTTCTGCCC -3'
Posted On2016-03-17