Incidental Mutation 'R4893:Krt1'
ID377432
Institutional Source Beutler Lab
Gene Symbol Krt1
Ensembl Gene ENSMUSG00000046834
Gene Namekeratin 1
SynonymsKrt-2.1, Krt2-1
MMRRC Submission 042498-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R4893 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101845426-101850794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101850120 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 203 (I203T)
Ref Sequence ENSEMBL: ENSMUSP00000023790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023790]
Predicted Effect probably damaging
Transcript: ENSMUST00000023790
AA Change: I203T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023790
Gene: ENSMUSG00000046834
AA Change: I203T

DomainStartEndE-ValueType
Pfam:Keratin_2_head 19 184 7.5e-35 PFAM
Filament 187 500 1.02e-154 SMART
Pfam:Keratin_2_tail 501 633 7.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231047
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the spinous and granular layers of the epidermis with family member KRT10 and mutations in these genes have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a dominant mutation exhibit significant blistering and skin erosions at birth and develop severe hyperkeratosis as adults. Mice homozygous for the dominant mutation also exhibit blistering, and die before weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik A G 8: 116,971,165 I401T probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Acss1 C A 2: 150,629,866 V323F probably damaging Het
Adgrf3 T G 5: 30,200,478 D286A probably benign Het
Akap5 T C 12: 76,329,969 V718A probably damaging Het
Ankk1 A G 9: 49,415,683 V732A probably benign Het
Antxr2 T A 5: 98,004,072 D180V probably damaging Het
Arfgef2 T G 2: 166,866,956 F1063V probably benign Het
Ascl5 A T 1: 136,051,179 I126F probably damaging Het
Aspm T A 1: 139,489,839 probably null Het
Atf6b T C 17: 34,648,612 S100P probably damaging Het
Baz2a C A 10: 128,123,415 H1266Q possibly damaging Het
Cdh4 A T 2: 179,847,419 probably benign Het
Celsr3 C G 9: 108,849,421 S3283C probably damaging Het
Clca4b C T 3: 144,925,173 V309M possibly damaging Het
Cnbd2 T C 2: 156,365,184 Y436H probably damaging Het
Csnk1a1 T C 18: 61,585,301 probably benign Het
Cstf1 C T 2: 172,380,524 R401C probably damaging Het
Cul3 A G 1: 80,288,850 I117T probably damaging Het
Dlgap3 A G 4: 127,194,983 D124G probably damaging Het
Dnah12 A G 14: 26,710,170 D381G possibly damaging Het
Dtna T C 18: 23,569,667 L85P probably damaging Het
Ephb2 A G 4: 136,659,753 I722T probably damaging Het
Epn3 A T 11: 94,491,996 F421I probably damaging Het
Fam160b1 T A 19: 57,381,756 H477Q probably benign Het
Fam83f T A 15: 80,691,955 L269H probably damaging Het
Gata4 G A 14: 63,201,596 A139V probably benign Het
Glce T C 9: 62,068,495 D241G probably benign Het
Gm17728 A T 17: 9,422,231 I58F probably benign Het
Inhba A T 13: 16,026,549 D232V possibly damaging Het
Itgb2l C A 16: 96,427,821 R394L probably benign Het
Klhl14 T C 18: 21,557,935 Y486C probably damaging Het
Lims2 T C 18: 31,941,811 probably null Het
Lrrc31 T G 3: 30,679,297 I423L probably benign Het
Map7d1 C T 4: 126,233,222 D732N unknown Het
Mau2 A T 8: 70,030,640 probably null Het
Mbtps1 G A 8: 119,518,193 R840W probably damaging Het
Morn3 T C 5: 123,037,682 I214M probably damaging Het
Mrpl44 A G 1: 79,777,865 K63E probably damaging Het
Muc20 T C 16: 32,794,672 T112A possibly damaging Het
Myo6 T A 9: 80,228,877 L94Q probably damaging Het
Nos1 C A 5: 117,952,877 T1423K possibly damaging Het
Olfr166 A G 16: 19,486,903 T22A probably benign Het
Olfr31 T C 14: 14,328,852 V247A probably damaging Het
Pdzd2 T C 15: 12,385,343 T1114A probably benign Het
Pgm1 T C 5: 64,105,940 V310A probably benign Het
Pi4ka T C 16: 17,377,036 E166G probably benign Het
Pign A T 1: 105,646,711 D303E probably damaging Het
Pik3c3 G T 18: 30,282,000 V149L probably benign Het
Pkd1l3 A T 8: 109,638,394 Y1126F probably benign Het
Pkd2l1 T A 19: 44,153,771 Q516L probably benign Het
Pnliprp2 C A 19: 58,771,421 Q355K probably benign Het
Pnpla7 T A 2: 25,053,676 Y1314* probably null Het
Ppp1r1b A G 11: 98,355,344 T51A possibly damaging Het
Prkcd A T 14: 30,599,425 S544T probably damaging Het
Pusl1 G A 4: 155,889,541 T252I probably benign Het
Rnf44 A G 13: 54,681,932 probably null Het
Slc24a2 A T 4: 87,226,908 V303E probably damaging Het
Slc28a2 T A 2: 122,455,216 probably null Het
Sox8 T C 17: 25,568,989 D162G probably damaging Het
Spag1 T C 15: 36,197,846 probably null Het
Taar6 T C 10: 23,985,400 I83V probably benign Het
Tes T A 6: 17,104,596 C359S probably damaging Het
Vmn2r4 A T 3: 64,406,255 L435H probably damaging Het
Zfhx3 G T 8: 108,957,007 D3693Y unknown Het
Zfp931 G A 2: 178,068,203 P130L probably damaging Het
Zfr T G 15: 12,136,542 V95G unknown Het
Zw10 A G 9: 49,074,025 E587G possibly damaging Het
Other mutations in Krt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Krt1 APN 15 101848193 missense probably damaging 1.00
IGL01478:Krt1 APN 15 101846286 splice site probably benign
IGL01919:Krt1 APN 15 101846376 missense unknown
IGL01970:Krt1 APN 15 101846864 missense possibly damaging 0.95
IGL02207:Krt1 APN 15 101848616 missense possibly damaging 0.94
IGL02643:Krt1 APN 15 101847044 missense probably benign 0.26
R0445:Krt1 UTSW 15 101847621 missense probably damaging 1.00
R0683:Krt1 UTSW 15 101850466 missense unknown
R1006:Krt1 UTSW 15 101847891 missense possibly damaging 0.96
R1163:Krt1 UTSW 15 101848165 nonsense probably null
R1217:Krt1 UTSW 15 101848981 missense possibly damaging 0.90
R1325:Krt1 UTSW 15 101848206 splice site probably null
R1965:Krt1 UTSW 15 101848992 missense probably benign 0.13
R1966:Krt1 UTSW 15 101848992 missense probably benign 0.13
R2101:Krt1 UTSW 15 101846187 missense unknown
R2302:Krt1 UTSW 15 101846187 missense unknown
R2697:Krt1 UTSW 15 101846929 missense probably damaging 1.00
R3034:Krt1 UTSW 15 101850633 missense unknown
R3079:Krt1 UTSW 15 101846187 missense unknown
R3080:Krt1 UTSW 15 101846187 missense unknown
R3891:Krt1 UTSW 15 101850412 missense unknown
R3892:Krt1 UTSW 15 101850412 missense unknown
R4180:Krt1 UTSW 15 101850378 small deletion probably benign
R4305:Krt1 UTSW 15 101850378 small deletion probably benign
R4334:Krt1 UTSW 15 101850378 small deletion probably benign
R4597:Krt1 UTSW 15 101847628 missense possibly damaging 0.90
R4625:Krt1 UTSW 15 101846187 missense unknown
R4626:Krt1 UTSW 15 101846187 missense unknown
R4628:Krt1 UTSW 15 101846187 missense unknown
R4629:Krt1 UTSW 15 101846187 missense unknown
R4630:Krt1 UTSW 15 101846187 missense unknown
R4631:Krt1 UTSW 15 101846187 missense unknown
R4632:Krt1 UTSW 15 101846187 missense unknown
R4633:Krt1 UTSW 15 101846187 missense unknown
R4948:Krt1 UTSW 15 101845941 missense unknown
R5193:Krt1 UTSW 15 101845922 missense unknown
R5254:Krt1 UTSW 15 101846368 missense unknown
R5448:Krt1 UTSW 15 101849029 nonsense probably null
R5494:Krt1 UTSW 15 101850714 missense unknown
R5567:Krt1 UTSW 15 101846905 missense probably benign 0.12
R5570:Krt1 UTSW 15 101846905 missense probably benign 0.12
R5869:Krt1 UTSW 15 101850131 missense probably damaging 1.00
R6200:Krt1 UTSW 15 101850378 small deletion probably benign
R6224:Krt1 UTSW 15 101850267 missense possibly damaging 0.92
R6326:Krt1 UTSW 15 101850249 missense probably damaging 1.00
R6517:Krt1 UTSW 15 101850267 missense possibly damaging 0.92
R6525:Krt1 UTSW 15 101850378 small deletion probably benign
R6918:Krt1 UTSW 15 101850177 missense probably damaging 1.00
R7018:Krt1 UTSW 15 101850378 small deletion probably benign
R7040:Krt1 UTSW 15 101850378 small deletion probably benign
R7110:Krt1 UTSW 15 101850378 small deletion probably benign
R7296:Krt1 UTSW 15 101850629 missense unknown
R7368:Krt1 UTSW 15 101846872 missense probably damaging 1.00
R7549:Krt1 UTSW 15 101850378 small deletion probably benign
R7706:Krt1 UTSW 15 101850378 small deletion probably benign
RF003:Krt1 UTSW 15 101850378 small deletion probably benign
X0067:Krt1 UTSW 15 101847755 critical splice donor site probably null
Z1177:Krt1 UTSW 15 101846016 missense unknown
Z1177:Krt1 UTSW 15 101850535 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTCATCAGCATCACTCCTG -3'
(R):5'- TTATGAACCTTGGAGGCGGTAG -3'

Sequencing Primer
(F):5'- GCATCACTCCTGAGAAGACTTTTAGC -3'
(R):5'- AGCATCTCCAAGAGTGTGGCTG -3'
Posted On2016-03-17