Incidental Mutation 'R4893:Csnk1a1'
ID377447
Institutional Source Beutler Lab
Gene Symbol Csnk1a1
Ensembl Gene ENSMUSG00000024576
Gene Namecasein kinase 1, alpha 1
Synonyms4632404G05Rik, CK1a, 5430427P18Rik, 2610208K14Rik
MMRRC Submission 042498-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4893 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location61555274-61590061 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 61585301 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115246] [ENSMUST00000163205] [ENSMUST00000165123] [ENSMUST00000165721] [ENSMUST00000166990] [ENSMUST00000167187] [ENSMUST00000170862]
Predicted Effect probably benign
Transcript: ENSMUST00000115246
SMART Domains Protein: ENSMUSP00000110901
Gene: ENSMUSG00000024576

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 281 1.7e-15 PFAM
Pfam:Pkinase 17 292 3.7e-39 PFAM
low complexity region 302 320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163205
SMART Domains Protein: ENSMUSP00000127144
Gene: ENSMUSG00000024576

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 281 2.6e-15 PFAM
Pfam:Pkinase 17 292 5.6e-39 PFAM
low complexity region 302 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164253
SMART Domains Protein: ENSMUSP00000129295
Gene: ENSMUSG00000024576

DomainStartEndE-ValueType
PDB:4JJR|B 2 114 9e-52 PDB
SCOP:d1csn__ 6 114 5e-26 SMART
low complexity region 115 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165123
SMART Domains Protein: ENSMUSP00000128871
Gene: ENSMUSG00000024576

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 281 1.3e-15 PFAM
Pfam:Pkinase 17 292 2.9e-39 PFAM
low complexity region 302 320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165721
SMART Domains Protein: ENSMUSP00000132083
Gene: ENSMUSG00000024576

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 281 1.5e-15 PFAM
Pfam:Pkinase 17 293 3.2e-39 PFAM
low complexity region 302 327 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000166990
AA Change: V366A
SMART Domains Protein: ENSMUSP00000131687
Gene: ENSMUSG00000024576
AA Change: V366A

DomainStartEndE-ValueType
Pfam:Pkinase 17 263 1e-28 PFAM
Pfam:Pkinase_Tyr 17 281 1.1e-15 PFAM
low complexity region 302 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167187
SMART Domains Protein: ENSMUSP00000127463
Gene: ENSMUSG00000024576

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 309 1.5e-12 PFAM
Pfam:Pkinase 17 319 1e-37 PFAM
low complexity region 330 348 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170482
Predicted Effect probably benign
Transcript: ENSMUST00000170862
SMART Domains Protein: ENSMUSP00000127265
Gene: ENSMUSG00000024576

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 309 1.6e-12 PFAM
Pfam:Pkinase 17 320 1.1e-37 PFAM
low complexity region 330 355 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik A G 8: 116,971,165 I401T probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Acss1 C A 2: 150,629,866 V323F probably damaging Het
Adgrf3 T G 5: 30,200,478 D286A probably benign Het
Akap5 T C 12: 76,329,969 V718A probably damaging Het
Ankk1 A G 9: 49,415,683 V732A probably benign Het
Antxr2 T A 5: 98,004,072 D180V probably damaging Het
Arfgef2 T G 2: 166,866,956 F1063V probably benign Het
Ascl5 A T 1: 136,051,179 I126F probably damaging Het
Aspm T A 1: 139,489,839 probably null Het
Atf6b T C 17: 34,648,612 S100P probably damaging Het
Baz2a C A 10: 128,123,415 H1266Q possibly damaging Het
Cdh4 A T 2: 179,847,419 probably benign Het
Celsr3 C G 9: 108,849,421 S3283C probably damaging Het
Clca4b C T 3: 144,925,173 V309M possibly damaging Het
Cnbd2 T C 2: 156,365,184 Y436H probably damaging Het
Cstf1 C T 2: 172,380,524 R401C probably damaging Het
Cul3 A G 1: 80,288,850 I117T probably damaging Het
Dlgap3 A G 4: 127,194,983 D124G probably damaging Het
Dnah12 A G 14: 26,710,170 D381G possibly damaging Het
Dtna T C 18: 23,569,667 L85P probably damaging Het
Ephb2 A G 4: 136,659,753 I722T probably damaging Het
Epn3 A T 11: 94,491,996 F421I probably damaging Het
Fam160b1 T A 19: 57,381,756 H477Q probably benign Het
Fam83f T A 15: 80,691,955 L269H probably damaging Het
Gata4 G A 14: 63,201,596 A139V probably benign Het
Glce T C 9: 62,068,495 D241G probably benign Het
Gm17728 A T 17: 9,422,231 I58F probably benign Het
Inhba A T 13: 16,026,549 D232V possibly damaging Het
Itgb2l C A 16: 96,427,821 R394L probably benign Het
Klhl14 T C 18: 21,557,935 Y486C probably damaging Het
Krt1 A G 15: 101,850,120 I203T probably damaging Het
Lims2 T C 18: 31,941,811 probably null Het
Lrrc31 T G 3: 30,679,297 I423L probably benign Het
Map7d1 C T 4: 126,233,222 D732N unknown Het
Mau2 A T 8: 70,030,640 probably null Het
Mbtps1 G A 8: 119,518,193 R840W probably damaging Het
Morn3 T C 5: 123,037,682 I214M probably damaging Het
Mrpl44 A G 1: 79,777,865 K63E probably damaging Het
Muc20 T C 16: 32,794,672 T112A possibly damaging Het
Myo6 T A 9: 80,228,877 L94Q probably damaging Het
Nos1 C A 5: 117,952,877 T1423K possibly damaging Het
Olfr166 A G 16: 19,486,903 T22A probably benign Het
Olfr31 T C 14: 14,328,852 V247A probably damaging Het
Pdzd2 T C 15: 12,385,343 T1114A probably benign Het
Pgm1 T C 5: 64,105,940 V310A probably benign Het
Pi4ka T C 16: 17,377,036 E166G probably benign Het
Pign A T 1: 105,646,711 D303E probably damaging Het
Pik3c3 G T 18: 30,282,000 V149L probably benign Het
Pkd1l3 A T 8: 109,638,394 Y1126F probably benign Het
Pkd2l1 T A 19: 44,153,771 Q516L probably benign Het
Pnliprp2 C A 19: 58,771,421 Q355K probably benign Het
Pnpla7 T A 2: 25,053,676 Y1314* probably null Het
Ppp1r1b A G 11: 98,355,344 T51A possibly damaging Het
Prkcd A T 14: 30,599,425 S544T probably damaging Het
Pusl1 G A 4: 155,889,541 T252I probably benign Het
Rnf44 A G 13: 54,681,932 probably null Het
Slc24a2 A T 4: 87,226,908 V303E probably damaging Het
Slc28a2 T A 2: 122,455,216 probably null Het
Sox8 T C 17: 25,568,989 D162G probably damaging Het
Spag1 T C 15: 36,197,846 probably null Het
Taar6 T C 10: 23,985,400 I83V probably benign Het
Tes T A 6: 17,104,596 C359S probably damaging Het
Vmn2r4 A T 3: 64,406,255 L435H probably damaging Het
Zfhx3 G T 8: 108,957,007 D3693Y unknown Het
Zfp931 G A 2: 178,068,203 P130L probably damaging Het
Zfr T G 15: 12,136,542 V95G unknown Het
Zw10 A G 9: 49,074,025 E587G possibly damaging Het
Other mutations in Csnk1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Csnk1a1 APN 18 61575450 missense probably damaging 1.00
IGL00984:Csnk1a1 APN 18 61575553 splice site probably benign
IGL03107:Csnk1a1 APN 18 61568305 missense probably damaging 1.00
R0513:Csnk1a1 UTSW 18 61576547 missense probably damaging 0.99
R1068:Csnk1a1 UTSW 18 61569563 critical splice donor site probably null
R1511:Csnk1a1 UTSW 18 61585250 intron probably benign
R1855:Csnk1a1 UTSW 18 61575427 splice site probably null
R2944:Csnk1a1 UTSW 18 61578689 missense probably benign 0.02
R4426:Csnk1a1 UTSW 18 61585310 intron probably benign
R5000:Csnk1a1 UTSW 18 61578769 missense probably damaging 1.00
R5070:Csnk1a1 UTSW 18 61555781 missense probably benign 0.02
R5095:Csnk1a1 UTSW 18 61575476 missense probably damaging 1.00
R6523:Csnk1a1 UTSW 18 61555758 missense probably benign 0.01
R6601:Csnk1a1 UTSW 18 61578758 missense probably damaging 1.00
R7425:Csnk1a1 UTSW 18 61585259 missense unknown
R7617:Csnk1a1 UTSW 18 61585316 missense unknown
R8358:Csnk1a1 UTSW 18 61580539 splice site probably null
R8379:Csnk1a1 UTSW 18 61555854 missense probably benign 0.00
R8411:Csnk1a1 UTSW 18 61555817 missense probably benign 0.00
X0028:Csnk1a1 UTSW 18 61578632 splice site probably null
X0064:Csnk1a1 UTSW 18 61569564 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTCATTACACTAATCCTCCAACGTTG -3'
(R):5'- GTGGTCAACATTGTTTAGGGAC -3'

Sequencing Primer
(F):5'- CCAACGTTGGTAATAGTCTTCATTC -3'
(R):5'- CCGGCTGAAGGTTAGTCTAAC -3'
Posted On2016-03-17