Incidental Mutation 'R4893:Fam160b1'
ID377451
Institutional Source Beutler Lab
Gene Symbol Fam160b1
Ensembl Gene ENSMUSG00000033478
Gene Namefamily with sequence similarity 160, member B1
Synonyms
MMRRC Submission 042498-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R4893 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location57361009-57389594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57381756 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 477 (H477Q)
Ref Sequence ENSEMBL: ENSMUSP00000048903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036407]
Predicted Effect probably benign
Transcript: ENSMUST00000036407
AA Change: H477Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000048903
Gene: ENSMUSG00000033478
AA Change: H477Q

DomainStartEndE-ValueType
Pfam:RAI16-like 78 495 1.1e-144 PFAM
low complexity region 713 724 N/A INTRINSIC
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik A G 8: 116,971,165 I401T probably damaging Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
Acss1 C A 2: 150,629,866 V323F probably damaging Het
Adgrf3 T G 5: 30,200,478 D286A probably benign Het
Akap5 T C 12: 76,329,969 V718A probably damaging Het
Ankk1 A G 9: 49,415,683 V732A probably benign Het
Antxr2 T A 5: 98,004,072 D180V probably damaging Het
Arfgef2 T G 2: 166,866,956 F1063V probably benign Het
Ascl5 A T 1: 136,051,179 I126F probably damaging Het
Aspm T A 1: 139,489,839 probably null Het
Atf6b T C 17: 34,648,612 S100P probably damaging Het
Baz2a C A 10: 128,123,415 H1266Q possibly damaging Het
Cdh4 A T 2: 179,847,419 probably benign Het
Celsr3 C G 9: 108,849,421 S3283C probably damaging Het
Clca4b C T 3: 144,925,173 V309M possibly damaging Het
Cnbd2 T C 2: 156,365,184 Y436H probably damaging Het
Csnk1a1 T C 18: 61,585,301 probably benign Het
Cstf1 C T 2: 172,380,524 R401C probably damaging Het
Cul3 A G 1: 80,288,850 I117T probably damaging Het
Dlgap3 A G 4: 127,194,983 D124G probably damaging Het
Dnah12 A G 14: 26,710,170 D381G possibly damaging Het
Dtna T C 18: 23,569,667 L85P probably damaging Het
Ephb2 A G 4: 136,659,753 I722T probably damaging Het
Epn3 A T 11: 94,491,996 F421I probably damaging Het
Fam83f T A 15: 80,691,955 L269H probably damaging Het
Gata4 G A 14: 63,201,596 A139V probably benign Het
Glce T C 9: 62,068,495 D241G probably benign Het
Gm17728 A T 17: 9,422,231 I58F probably benign Het
Inhba A T 13: 16,026,549 D232V possibly damaging Het
Itgb2l C A 16: 96,427,821 R394L probably benign Het
Klhl14 T C 18: 21,557,935 Y486C probably damaging Het
Krt1 A G 15: 101,850,120 I203T probably damaging Het
Lims2 T C 18: 31,941,811 probably null Het
Lrrc31 T G 3: 30,679,297 I423L probably benign Het
Map7d1 C T 4: 126,233,222 D732N unknown Het
Mau2 A T 8: 70,030,640 probably null Het
Mbtps1 G A 8: 119,518,193 R840W probably damaging Het
Morn3 T C 5: 123,037,682 I214M probably damaging Het
Mrpl44 A G 1: 79,777,865 K63E probably damaging Het
Muc20 T C 16: 32,794,672 T112A possibly damaging Het
Myo6 T A 9: 80,228,877 L94Q probably damaging Het
Nos1 C A 5: 117,952,877 T1423K possibly damaging Het
Olfr166 A G 16: 19,486,903 T22A probably benign Het
Olfr31 T C 14: 14,328,852 V247A probably damaging Het
Pdzd2 T C 15: 12,385,343 T1114A probably benign Het
Pgm1 T C 5: 64,105,940 V310A probably benign Het
Pi4ka T C 16: 17,377,036 E166G probably benign Het
Pign A T 1: 105,646,711 D303E probably damaging Het
Pik3c3 G T 18: 30,282,000 V149L probably benign Het
Pkd1l3 A T 8: 109,638,394 Y1126F probably benign Het
Pkd2l1 T A 19: 44,153,771 Q516L probably benign Het
Pnliprp2 C A 19: 58,771,421 Q355K probably benign Het
Pnpla7 T A 2: 25,053,676 Y1314* probably null Het
Ppp1r1b A G 11: 98,355,344 T51A possibly damaging Het
Prkcd A T 14: 30,599,425 S544T probably damaging Het
Pusl1 G A 4: 155,889,541 T252I probably benign Het
Rnf44 A G 13: 54,681,932 probably null Het
Slc24a2 A T 4: 87,226,908 V303E probably damaging Het
Slc28a2 T A 2: 122,455,216 probably null Het
Sox8 T C 17: 25,568,989 D162G probably damaging Het
Spag1 T C 15: 36,197,846 probably null Het
Taar6 T C 10: 23,985,400 I83V probably benign Het
Tes T A 6: 17,104,596 C359S probably damaging Het
Vmn2r4 A T 3: 64,406,255 L435H probably damaging Het
Zfhx3 G T 8: 108,957,007 D3693Y unknown Het
Zfp931 G A 2: 178,068,203 P130L probably damaging Het
Zfr T G 15: 12,136,542 V95G unknown Het
Zw10 A G 9: 49,074,025 E587G possibly damaging Het
Other mutations in Fam160b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Fam160b1 APN 19 57381345 missense probably benign 0.00
IGL02642:Fam160b1 APN 19 57385350 missense possibly damaging 0.55
IGL03152:Fam160b1 APN 19 57378832 missense probably damaging 0.99
fredericksburg UTSW 19 57384123 nonsense probably null
R0001:Fam160b1 UTSW 19 57381756 missense probably benign 0.01
R0123:Fam160b1 UTSW 19 57381407 missense probably benign 0.00
R0368:Fam160b1 UTSW 19 57368578 missense possibly damaging 0.91
R0446:Fam160b1 UTSW 19 57381407 missense probably benign 0.00
R0508:Fam160b1 UTSW 19 57378742 missense probably benign 0.04
R0926:Fam160b1 UTSW 19 57381090 missense probably damaging 1.00
R1122:Fam160b1 UTSW 19 57382301 missense probably benign 0.00
R1344:Fam160b1 UTSW 19 57371162 missense possibly damaging 0.72
R1398:Fam160b1 UTSW 19 57372926 splice site probably benign
R1418:Fam160b1 UTSW 19 57371162 missense possibly damaging 0.72
R1506:Fam160b1 UTSW 19 57368575 missense probably benign 0.30
R1530:Fam160b1 UTSW 19 57386305 missense probably damaging 0.99
R1695:Fam160b1 UTSW 19 57379171 missense probably damaging 1.00
R1868:Fam160b1 UTSW 19 57386305 missense possibly damaging 0.75
R1974:Fam160b1 UTSW 19 57385377 missense probably damaging 0.99
R2004:Fam160b1 UTSW 19 57381892 missense probably benign
R2893:Fam160b1 UTSW 19 57384169 missense probably benign 0.01
R3011:Fam160b1 UTSW 19 57385288 missense probably damaging 1.00
R3963:Fam160b1 UTSW 19 57373010 missense possibly damaging 0.77
R4416:Fam160b1 UTSW 19 57385397 splice site probably null
R4613:Fam160b1 UTSW 19 57371187 missense probably damaging 0.99
R4735:Fam160b1 UTSW 19 57371229 missense probably damaging 1.00
R4937:Fam160b1 UTSW 19 57378637 missense probably benign
R5049:Fam160b1 UTSW 19 57386305 missense possibly damaging 0.75
R5050:Fam160b1 UTSW 19 57383170 missense probably damaging 1.00
R5080:Fam160b1 UTSW 19 57373281 missense probably damaging 1.00
R5176:Fam160b1 UTSW 19 57371181 missense probably damaging 0.98
R5317:Fam160b1 UTSW 19 57381709 splice site probably null
R5347:Fam160b1 UTSW 19 57378619 missense probably benign
R5497:Fam160b1 UTSW 19 57381151 splice site probably null
R5969:Fam160b1 UTSW 19 57384123 nonsense probably null
R6418:Fam160b1 UTSW 19 57381734 missense probably benign 0.18
R6426:Fam160b1 UTSW 19 57383178 missense probably damaging 1.00
R6765:Fam160b1 UTSW 19 57378745 missense probably benign
R7472:Fam160b1 UTSW 19 57368585 missense probably damaging 1.00
R7583:Fam160b1 UTSW 19 57378602 missense probably benign 0.01
R7672:Fam160b1 UTSW 19 57385318 missense possibly damaging 0.95
X0023:Fam160b1 UTSW 19 57384147 nonsense probably null
X0062:Fam160b1 UTSW 19 57385257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATGTTCAACTGTGCTG -3'
(R):5'- TAGAGAACCCAAGTCCTGGC -3'

Sequencing Primer
(F):5'- ATGTGTCCCCAGGATTGAAC -3'
(R):5'- AAGTCCTGGCTGGGGAGAC -3'
Posted On2016-03-17