Incidental Mutation 'R4894:Klhl20'
ID377458
Institutional Source Beutler Lab
Gene Symbol Klhl20
Ensembl Gene ENSMUSG00000026705
Gene Namekelch-like 20
SynonymsD930050H05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R4894 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location161088375-161131511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 161109532 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 91 (M91K)
Ref Sequence ENSEMBL: ENSMUSP00000114044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111611] [ENSMUST00000117467]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111611
AA Change: M91K

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107238
Gene: ENSMUSG00000026705
AA Change: M91K

DomainStartEndE-ValueType
BTB 63 160 2.73e-31 SMART
BACK 165 267 1.98e-41 SMART
Kelch 314 360 8.45e-16 SMART
Kelch 361 408 1.35e-14 SMART
Kelch 409 455 5.12e-15 SMART
Kelch 456 502 1.22e-12 SMART
Kelch 503 549 1.35e-14 SMART
Kelch 550 596 1.59e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117467
AA Change: M91K

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114044
Gene: ENSMUSG00000026705
AA Change: M91K

DomainStartEndE-ValueType
BTB 63 160 2.73e-31 SMART
BACK 165 267 1.98e-41 SMART
Kelch 314 360 8.45e-16 SMART
Kelch 361 408 1.35e-14 SMART
Kelch 409 455 5.12e-15 SMART
Kelch 456 502 1.22e-12 SMART
Kelch 503 549 1.35e-14 SMART
Kelch 550 596 1.59e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148952
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kelch family of proteins, which is characterized by a 44-56 amino acid repeat motif. The kelch motif appears in many different polypeptide contexts and contains multiple potential protein-protein contact sites. Members of this family are present both throughout the cell and extracellularly, with diverse activities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit male sterility. Mice homozygous for a gene trap allele exhibit corneal vascularization and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,299,084 Y176* probably null Het
Akap13 T A 7: 75,725,320 M1900K possibly damaging Het
Ankrd36 A G 11: 5,635,332 E381G probably damaging Het
Ap3s1 T C 18: 46,758,116 probably null Het
Cacna1e G T 1: 154,488,805 S341* probably null Het
Camk1d G A 2: 5,354,728 S161L probably damaging Het
Cdh23 G T 10: 60,337,851 H1619Q probably benign Het
Chd7 T A 4: 8,838,629 I1276N probably damaging Het
Clca1 A G 3: 145,013,901 V436A probably damaging Het
Ctcfl G A 2: 173,117,403 P177S probably benign Het
Dab2ip A G 2: 35,730,527 probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epc1 A T 18: 6,449,011 S495R probably benign Het
Espl1 A G 15: 102,322,323 probably null Het
Eya4 T C 10: 23,109,854 E583G possibly damaging Het
Fam111a C G 19: 12,588,549 T554R probably benign Het
Fbxo18 A T 2: 11,762,960 I359N probably damaging Het
Fer1l6 T C 15: 58,618,902 C1023R probably damaging Het
Gm14139 T A 2: 150,191,979 C104* probably null Het
Helz2 G C 2: 181,236,147 P953A probably benign Het
Ifi204 G T 1: 173,760,242 S117Y probably damaging Het
Igfn1 G A 1: 135,954,782 T2775M probably damaging Het
Igsf9 A G 1: 172,498,067 T1101A probably benign Het
Ipo13 A C 4: 117,903,441 I614S probably damaging Het
Ipo13 A G 4: 117,904,490 I476T possibly damaging Het
Kdm2b C A 5: 122,940,967 E308* probably null Het
Klrb1f T C 6: 129,053,188 F64L probably benign Het
Ldlrad3 C T 2: 102,057,948 C106Y probably damaging Het
Lilra6 T C 7: 3,912,531 T161A probably benign Het
Lrriq1 A T 10: 103,161,752 M1334K possibly damaging Het
Mepe C G 5: 104,325,402 P3R probably damaging Het
Mgat4e A G 1: 134,541,118 V396A probably benign Het
Nfx1 T G 4: 40,996,877 S651A probably damaging Het
Olfr1214 T C 2: 88,987,439 I254M possibly damaging Het
Olfr1337 A T 4: 118,782,286 C100S probably damaging Het
Olfr1361 T C 13: 21,659,182 N47S probably damaging Het
Rag2 T C 2: 101,629,677 S111P probably damaging Het
Rai1 T A 11: 60,186,746 D545E probably damaging Het
Ralgps1 A G 2: 33,143,103 V498A possibly damaging Het
Rasal2 G A 1: 157,192,804 S205L probably damaging Het
Rec8 T C 14: 55,625,330 L582P probably damaging Het
Retn G A 8: 3,657,358 R106H probably damaging Het
Rnf112 A G 11: 61,452,662 L116P probably damaging Het
Rnf213 T C 11: 119,481,240 Y4885H probably damaging Het
Sacm1l A G 9: 123,582,344 I399M probably benign Het
Sez6 G T 11: 77,975,260 G738V probably damaging Het
Spata17 A G 1: 187,140,446 V56A probably benign Het
Spata31d1a A T 13: 59,701,728 V862D probably damaging Het
Sptb A G 12: 76,624,994 probably null Het
Srpk2 C A 5: 23,545,529 G59W probably damaging Het
Ttc30a1 T C 2: 75,979,744 *665W probably null Het
Tyro3 T C 2: 119,802,298 S96P probably damaging Het
Ube2v1 A G 2: 167,610,360 S108P probably damaging Het
Usp2 C T 9: 44,075,828 S141L probably benign Het
Vamp5 T C 6: 72,370,198 D46G possibly damaging Het
Vmn1r23 T A 6: 57,926,325 Q156L probably benign Het
Vmn2r6 C T 3: 64,547,408 S490N probably benign Het
Vps39 A T 2: 120,352,959 I10N probably damaging Het
Vwf C T 6: 125,645,934 Q1755* probably null Het
Wdfy4 A T 14: 33,155,760 H82Q probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Wdr72 A G 9: 74,210,561 T852A probably benign Het
Zfp1 T A 8: 111,669,723 C92* probably null Het
Zfp426 A T 9: 20,475,073 probably benign Het
Zfp442 C T 2: 150,411,210 probably null Het
Zfp74 T C 7: 29,936,045 probably benign Het
Other mutations in Klhl20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Klhl20 APN 1 161109755 missense probably benign 0.00
IGL00903:Klhl20 APN 1 161090506 missense probably benign 0.00
IGL01574:Klhl20 APN 1 161093726 missense probably damaging 1.00
IGL01721:Klhl20 APN 1 161095587 missense probably damaging 1.00
IGL01933:Klhl20 APN 1 161106787 missense probably damaging 1.00
IGL02187:Klhl20 APN 1 161109710 missense probably benign 0.05
IGL02634:Klhl20 APN 1 161098365 missense probably damaging 0.98
IGL02691:Klhl20 APN 1 161106874 splice site probably benign
R0102:Klhl20 UTSW 1 161090445 nonsense probably null
R0102:Klhl20 UTSW 1 161090445 nonsense probably null
R0639:Klhl20 UTSW 1 161093711 missense probably damaging 1.00
R1730:Klhl20 UTSW 1 161102990 missense possibly damaging 0.82
R1856:Klhl20 UTSW 1 161106742 missense probably benign 0.00
R2016:Klhl20 UTSW 1 161103038 missense probably damaging 0.98
R2901:Klhl20 UTSW 1 161109552 nonsense probably null
R4822:Klhl20 UTSW 1 161093763 nonsense probably null
R4830:Klhl20 UTSW 1 161098376 missense probably benign 0.00
R4981:Klhl20 UTSW 1 161103005 missense possibly damaging 0.48
R5018:Klhl20 UTSW 1 161101586 missense probably damaging 0.98
R5023:Klhl20 UTSW 1 161109220 critical splice donor site probably null
R5108:Klhl20 UTSW 1 161099250 missense probably damaging 0.99
R5216:Klhl20 UTSW 1 161093679 critical splice donor site probably null
R5659:Klhl20 UTSW 1 161090470 missense probably damaging 1.00
R6159:Klhl20 UTSW 1 161105467 missense probably damaging 1.00
R6836:Klhl20 UTSW 1 161105406 missense probably benign 0.18
R6914:Klhl20 UTSW 1 161093696 missense possibly damaging 0.50
R6915:Klhl20 UTSW 1 161093696 missense possibly damaging 0.50
R6920:Klhl20 UTSW 1 161093696 missense possibly damaging 0.50
R7706:Klhl20 UTSW 1 161109257 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTATTTCTGCCAGCTGGAGG -3'
(R):5'- ATGTAACAAGCCGCTGCAC -3'

Sequencing Primer
(F):5'- CCAGCTGGAGGAGGCAAGC -3'
(R):5'- CAAGCTGCCAGAAGGGGTTC -3'
Posted On2016-03-17