Incidental Mutation 'R4894:Igsf9'
ID377459
Institutional Source Beutler Lab
Gene Symbol Igsf9
Ensembl Gene ENSMUSG00000037995
Gene Nameimmunoglobulin superfamily, member 9
SynonymsNRT1, Dasm1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4894 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172481788-172498878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172498067 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1101 (T1101A)
Ref Sequence ENSEMBL: ENSMUSP00000106866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052629] [ENSMUST00000111228] [ENSMUST00000111230] [ENSMUST00000111235] [ENSMUST00000127482] [ENSMUST00000192460]
Predicted Effect probably benign
Transcript: ENSMUST00000052629
AA Change: T1101A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058275
Gene: ENSMUSG00000037995
AA Change: T1101A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
FN3 508 593 1.82e-4 SMART
FN3 624 705 7.01e-6 SMART
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
low complexity region 909 930 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
low complexity region 1143 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111228
SMART Domains Protein: ENSMUSP00000106859
Gene: ENSMUSG00000026547

DomainStartEndE-ValueType
CH 26 132 2.84e-24 SMART
Pfam:Calponin 174 198 7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111230
SMART Domains Protein: ENSMUSP00000106861
Gene: ENSMUSG00000026547

DomainStartEndE-ValueType
CH 26 132 2.84e-24 SMART
Pfam:Calponin 174 199 1.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111235
AA Change: T1101A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106866
Gene: ENSMUSG00000037995
AA Change: T1101A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
FN3 508 593 1.82e-4 SMART
FN3 624 705 7.01e-6 SMART
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
low complexity region 909 930 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
low complexity region 1143 1165 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125258
Predicted Effect probably benign
Transcript: ENSMUST00000127482
SMART Domains Protein: ENSMUSP00000117854
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155426
Predicted Effect probably benign
Transcript: ENSMUST00000192460
SMART Domains Protein: ENSMUSP00000141983
Gene: ENSMUSG00000026547

DomainStartEndE-ValueType
Pfam:CH 27 90 9.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193620
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but show abnormal miniature inhibitory postsynaptic currents and increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,299,084 Y176* probably null Het
Akap13 T A 7: 75,725,320 M1900K possibly damaging Het
Ankrd36 A G 11: 5,635,332 E381G probably damaging Het
Ap3s1 T C 18: 46,758,116 probably null Het
Cacna1e G T 1: 154,488,805 S341* probably null Het
Camk1d G A 2: 5,354,728 S161L probably damaging Het
Cdh23 G T 10: 60,337,851 H1619Q probably benign Het
Chd7 T A 4: 8,838,629 I1276N probably damaging Het
Clca1 A G 3: 145,013,901 V436A probably damaging Het
Ctcfl G A 2: 173,117,403 P177S probably benign Het
Dab2ip A G 2: 35,730,527 probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epc1 A T 18: 6,449,011 S495R probably benign Het
Espl1 A G 15: 102,322,323 probably null Het
Eya4 T C 10: 23,109,854 E583G possibly damaging Het
Fam111a C G 19: 12,588,549 T554R probably benign Het
Fbxo18 A T 2: 11,762,960 I359N probably damaging Het
Fer1l6 T C 15: 58,618,902 C1023R probably damaging Het
Gm14139 T A 2: 150,191,979 C104* probably null Het
Helz2 G C 2: 181,236,147 P953A probably benign Het
Ifi204 G T 1: 173,760,242 S117Y probably damaging Het
Igfn1 G A 1: 135,954,782 T2775M probably damaging Het
Ipo13 A C 4: 117,903,441 I614S probably damaging Het
Ipo13 A G 4: 117,904,490 I476T possibly damaging Het
Kdm2b C A 5: 122,940,967 E308* probably null Het
Klhl20 A T 1: 161,109,532 M91K possibly damaging Het
Klrb1f T C 6: 129,053,188 F64L probably benign Het
Ldlrad3 C T 2: 102,057,948 C106Y probably damaging Het
Lilra6 T C 7: 3,912,531 T161A probably benign Het
Lrriq1 A T 10: 103,161,752 M1334K possibly damaging Het
Mepe C G 5: 104,325,402 P3R probably damaging Het
Mgat4e A G 1: 134,541,118 V396A probably benign Het
Nfx1 T G 4: 40,996,877 S651A probably damaging Het
Olfr1214 T C 2: 88,987,439 I254M possibly damaging Het
Olfr1337 A T 4: 118,782,286 C100S probably damaging Het
Olfr1361 T C 13: 21,659,182 N47S probably damaging Het
Rag2 T C 2: 101,629,677 S111P probably damaging Het
Rai1 T A 11: 60,186,746 D545E probably damaging Het
Ralgps1 A G 2: 33,143,103 V498A possibly damaging Het
Rasal2 G A 1: 157,192,804 S205L probably damaging Het
Rec8 T C 14: 55,625,330 L582P probably damaging Het
Retn G A 8: 3,657,358 R106H probably damaging Het
Rnf112 A G 11: 61,452,662 L116P probably damaging Het
Rnf213 T C 11: 119,481,240 Y4885H probably damaging Het
Sacm1l A G 9: 123,582,344 I399M probably benign Het
Sez6 G T 11: 77,975,260 G738V probably damaging Het
Spata17 A G 1: 187,140,446 V56A probably benign Het
Spata31d1a A T 13: 59,701,728 V862D probably damaging Het
Sptb A G 12: 76,624,994 probably null Het
Srpk2 C A 5: 23,545,529 G59W probably damaging Het
Ttc30a1 T C 2: 75,979,744 *665W probably null Het
Tyro3 T C 2: 119,802,298 S96P probably damaging Het
Ube2v1 A G 2: 167,610,360 S108P probably damaging Het
Usp2 C T 9: 44,075,828 S141L probably benign Het
Vamp5 T C 6: 72,370,198 D46G possibly damaging Het
Vmn1r23 T A 6: 57,926,325 Q156L probably benign Het
Vmn2r6 C T 3: 64,547,408 S490N probably benign Het
Vps39 A T 2: 120,352,959 I10N probably damaging Het
Vwf C T 6: 125,645,934 Q1755* probably null Het
Wdfy4 A T 14: 33,155,760 H82Q probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Wdr72 A G 9: 74,210,561 T852A probably benign Het
Zfp1 T A 8: 111,669,723 C92* probably null Het
Zfp426 A T 9: 20,475,073 probably benign Het
Zfp442 C T 2: 150,411,210 probably null Het
Zfp74 T C 7: 29,936,045 probably benign Het
Other mutations in Igsf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Igsf9 APN 1 172496636 missense probably benign
IGL01665:Igsf9 APN 1 172492171 nonsense probably null
IGL01808:Igsf9 APN 1 172484803 missense probably benign 0.03
IGL02480:Igsf9 APN 1 172496913 missense possibly damaging 0.88
IGL02480:Igsf9 APN 1 172484778 intron probably benign
IGL03087:Igsf9 APN 1 172490743 missense probably benign 0.00
R1258:Igsf9 UTSW 1 172492155 missense probably benign 0.02
R1419:Igsf9 UTSW 1 172498011 missense probably damaging 1.00
R2246:Igsf9 UTSW 1 172491649 missense probably benign 0.21
R2427:Igsf9 UTSW 1 172490739 missense probably damaging 0.98
R3900:Igsf9 UTSW 1 172489558 missense probably damaging 1.00
R4334:Igsf9 UTSW 1 172494212 nonsense probably null
R4831:Igsf9 UTSW 1 172491888 missense probably damaging 1.00
R4844:Igsf9 UTSW 1 172497170 missense probably benign 0.00
R5016:Igsf9 UTSW 1 172490712 missense probably damaging 1.00
R5358:Igsf9 UTSW 1 172484511 missense probably benign 0.01
R5705:Igsf9 UTSW 1 172494771 missense possibly damaging 0.80
R5762:Igsf9 UTSW 1 172498438 missense probably damaging 1.00
R6058:Igsf9 UTSW 1 172484889 missense probably damaging 1.00
R6510:Igsf9 UTSW 1 172490297 missense possibly damaging 0.78
R6821:Igsf9 UTSW 1 172484493 missense probably benign 0.39
R6822:Igsf9 UTSW 1 172497163 missense possibly damaging 0.95
R6829:Igsf9 UTSW 1 172495674 missense probably benign
R6848:Igsf9 UTSW 1 172495762 missense probably damaging 1.00
R6874:Igsf9 UTSW 1 172494529 missense probably benign
R7224:Igsf9 UTSW 1 172494782 missense probably damaging 1.00
R7284:Igsf9 UTSW 1 172496912 missense probably damaging 0.99
R7292:Igsf9 UTSW 1 172491757 critical splice donor site probably null
R7409:Igsf9 UTSW 1 172495274 missense probably benign
R7744:Igsf9 UTSW 1 172492185 missense probably benign 0.37
R7826:Igsf9 UTSW 1 172491630 missense probably benign 0.01
R7893:Igsf9 UTSW 1 172497302 missense probably damaging 1.00
V7732:Igsf9 UTSW 1 172490393 missense probably benign 0.19
Z1176:Igsf9 UTSW 1 172492149 missense probably damaging 0.99
Z1176:Igsf9 UTSW 1 172495226 missense probably benign 0.27
Z1177:Igsf9 UTSW 1 172494872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCCAGGAAGTGCAATCTG -3'
(R):5'- AGTCCTGAGGCTCCAAAAGG -3'

Sequencing Primer
(F):5'- GTGCAATCTGCTTTAGAGGAACCTC -3'
(R):5'- TCCAAAAGGCCTTTGCGTG -3'
Posted On2016-03-17