Incidental Mutation 'R4894:Spata17'
ID 377461
Institutional Source Beutler Lab
Gene Symbol Spata17
Ensembl Gene ENSMUSG00000026611
Gene Name spermatogenesis associated 17
Synonyms 4930513F16Rik, 4930504I07Rik, 1700065F16Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R4894 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 186776845-186947662 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 186872643 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 56 (V56A)
Ref Sequence ENSEMBL: ENSMUSP00000139329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027908] [ENSMUST00000110945] [ENSMUST00000183819] [ENSMUST00000183931] [ENSMUST00000183996] [ENSMUST00000184543]
AlphaFold Q9D552
Predicted Effect probably benign
Transcript: ENSMUST00000027908
AA Change: V165A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027908
Gene: ENSMUSG00000026611
AA Change: V165A

DomainStartEndE-ValueType
IQ 47 69 5.27e0 SMART
IQ 70 92 1.77e-2 SMART
IQ 106 128 1.4e1 SMART
coiled coil region 133 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110945
AA Change: V165A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106570
Gene: ENSMUSG00000026611
AA Change: V165A

DomainStartEndE-ValueType
IQ 47 69 5.27e0 SMART
IQ 70 92 1.77e-2 SMART
IQ 106 128 1.4e1 SMART
coiled coil region 133 174 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183656
Predicted Effect probably benign
Transcript: ENSMUST00000183819
AA Change: V165A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138855
Gene: ENSMUSG00000026611
AA Change: V165A

DomainStartEndE-ValueType
IQ 47 69 5.27e0 SMART
IQ 70 92 1.77e-2 SMART
IQ 106 128 1.4e1 SMART
coiled coil region 133 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183931
AA Change: V56A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139329
Gene: ENSMUSG00000026611
AA Change: V56A

DomainStartEndE-ValueType
low complexity region 39 63 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000183996
AA Change: V9A
SMART Domains Protein: ENSMUSP00000139073
Gene: ENSMUSG00000026611
AA Change: V9A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000184543
AA Change: V9A
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,609,975 (GRCm39) Y176* probably null Het
Akap13 T A 7: 75,375,068 (GRCm39) M1900K possibly damaging Het
Ankrd36 A G 11: 5,585,332 (GRCm39) E381G probably damaging Het
Ap3s1 T C 18: 46,891,183 (GRCm39) probably null Het
Cacna1e G T 1: 154,364,551 (GRCm39) S341* probably null Het
Camk1d G A 2: 5,359,539 (GRCm39) S161L probably damaging Het
Cdh23 G T 10: 60,173,630 (GRCm39) H1619Q probably benign Het
Chd7 T A 4: 8,838,629 (GRCm39) I1276N probably damaging Het
Clca3a1 A G 3: 144,719,662 (GRCm39) V436A probably damaging Het
Ctcfl G A 2: 172,959,196 (GRCm39) P177S probably benign Het
Dab2ip A G 2: 35,620,539 (GRCm39) probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Epc1 A T 18: 6,449,011 (GRCm39) S495R probably benign Het
Espl1 A G 15: 102,230,758 (GRCm39) probably null Het
Eya4 T C 10: 22,985,753 (GRCm39) E583G possibly damaging Het
Fam111a C G 19: 12,565,913 (GRCm39) T554R probably benign Het
Fbh1 A T 2: 11,767,771 (GRCm39) I359N probably damaging Het
Fer1l6 T C 15: 58,490,751 (GRCm39) C1023R probably damaging Het
Helz2 G C 2: 180,877,940 (GRCm39) P953A probably benign Het
Ifi204 G T 1: 173,587,808 (GRCm39) S117Y probably damaging Het
Ift70a1 T C 2: 75,810,088 (GRCm39) *665W probably null Het
Igfn1 G A 1: 135,882,520 (GRCm39) T2775M probably damaging Het
Igsf9 A G 1: 172,325,634 (GRCm39) T1101A probably benign Het
Ipo13 A C 4: 117,760,638 (GRCm39) I614S probably damaging Het
Ipo13 A G 4: 117,761,687 (GRCm39) I476T possibly damaging Het
Kdm2b C A 5: 123,079,030 (GRCm39) E308* probably null Het
Klhl20 A T 1: 160,937,102 (GRCm39) M91K possibly damaging Het
Klrb1f T C 6: 129,030,151 (GRCm39) F64L probably benign Het
Ldlrad3 C T 2: 101,888,293 (GRCm39) C106Y probably damaging Het
Lilra6 T C 7: 3,915,530 (GRCm39) T161A probably benign Het
Lrriq1 A T 10: 102,997,613 (GRCm39) M1334K possibly damaging Het
Mepe C G 5: 104,473,268 (GRCm39) P3R probably damaging Het
Mgat4e A G 1: 134,468,856 (GRCm39) V396A probably benign Het
Nfx1 T G 4: 40,996,877 (GRCm39) S651A probably damaging Het
Or10ak13 A T 4: 118,639,483 (GRCm39) C100S probably damaging Het
Or2w6 T C 13: 21,843,352 (GRCm39) N47S probably damaging Het
Or4c109 T C 2: 88,817,783 (GRCm39) I254M possibly damaging Het
Rag2 T C 2: 101,460,022 (GRCm39) S111P probably damaging Het
Rai1 T A 11: 60,077,572 (GRCm39) D545E probably damaging Het
Ralgps1 A G 2: 33,033,115 (GRCm39) V498A possibly damaging Het
Rasal2 G A 1: 157,020,374 (GRCm39) S205L probably damaging Het
Rec8 T C 14: 55,862,787 (GRCm39) L582P probably damaging Het
Retn G A 8: 3,707,358 (GRCm39) R106H probably damaging Het
Rnf112 A G 11: 61,343,488 (GRCm39) L116P probably damaging Het
Rnf213 T C 11: 119,372,066 (GRCm39) Y4885H probably damaging Het
Sacm1l A G 9: 123,411,409 (GRCm39) I399M probably benign Het
Sez6 G T 11: 77,866,086 (GRCm39) G738V probably damaging Het
Spata31d1a A T 13: 59,849,542 (GRCm39) V862D probably damaging Het
Sptb A G 12: 76,671,768 (GRCm39) probably null Het
Srpk2 C A 5: 23,750,527 (GRCm39) G59W probably damaging Het
Tyro3 T C 2: 119,632,779 (GRCm39) S96P probably damaging Het
Ube2v1 A G 2: 167,452,280 (GRCm39) S108P probably damaging Het
Usp2 C T 9: 43,987,125 (GRCm39) S141L probably benign Het
Vamp5 T C 6: 72,347,181 (GRCm39) D46G possibly damaging Het
Vmn1r23 T A 6: 57,903,310 (GRCm39) Q156L probably benign Het
Vmn2r6 C T 3: 64,454,829 (GRCm39) S490N probably benign Het
Vps39 A T 2: 120,183,440 (GRCm39) I10N probably damaging Het
Vwf C T 6: 125,622,897 (GRCm39) Q1755* probably null Het
Wdfy4 A T 14: 32,877,717 (GRCm39) H82Q probably benign Het
Wdr24 T C 17: 26,045,101 (GRCm39) Y279H probably damaging Het
Wdr72 A G 9: 74,117,843 (GRCm39) T852A probably benign Het
Zfp1 T A 8: 112,396,355 (GRCm39) C92* probably null Het
Zfp1004 T A 2: 150,033,899 (GRCm39) C104* probably null Het
Zfp426 A T 9: 20,386,369 (GRCm39) probably benign Het
Zfp442 C T 2: 150,253,130 (GRCm39) probably null Het
Zfp74 T C 7: 29,635,470 (GRCm39) probably benign Het
Other mutations in Spata17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Spata17 APN 1 186,849,536 (GRCm39) missense probably benign 0.34
IGL02101:Spata17 APN 1 186,849,657 (GRCm39) missense probably benign 0.40
IGL02268:Spata17 APN 1 186,872,595 (GRCm39) missense probably damaging 0.97
IGL02406:Spata17 APN 1 186,849,458 (GRCm39) critical splice donor site probably null
IGL02429:Spata17 APN 1 186,872,631 (GRCm39) missense possibly damaging 0.66
IGL03333:Spata17 APN 1 186,872,667 (GRCm39) start codon destroyed probably null
R0147:Spata17 UTSW 1 186,844,798 (GRCm39) missense probably damaging 1.00
R0148:Spata17 UTSW 1 186,844,798 (GRCm39) missense probably damaging 1.00
R0269:Spata17 UTSW 1 186,830,069 (GRCm39) missense probably benign 0.02
R1521:Spata17 UTSW 1 186,926,191 (GRCm39) missense probably damaging 0.96
R1620:Spata17 UTSW 1 186,915,412 (GRCm39) intron probably benign
R2017:Spata17 UTSW 1 186,780,650 (GRCm39) missense possibly damaging 0.73
R2113:Spata17 UTSW 1 186,830,108 (GRCm39) missense possibly damaging 0.93
R2251:Spata17 UTSW 1 186,780,670 (GRCm39) missense possibly damaging 0.96
R4260:Spata17 UTSW 1 186,780,677 (GRCm39) missense possibly damaging 0.53
R4572:Spata17 UTSW 1 186,926,193 (GRCm39) missense possibly damaging 0.91
R4910:Spata17 UTSW 1 186,926,208 (GRCm39) missense probably damaging 0.98
R6277:Spata17 UTSW 1 186,926,151 (GRCm39) nonsense probably null
R7200:Spata17 UTSW 1 186,844,700 (GRCm39) missense probably benign 0.00
R7621:Spata17 UTSW 1 186,854,833 (GRCm39) splice site probably null
R7735:Spata17 UTSW 1 186,872,577 (GRCm39) missense unknown
R7990:Spata17 UTSW 1 186,872,592 (GRCm39) missense unknown
R8115:Spata17 UTSW 1 186,849,653 (GRCm39) missense probably damaging 1.00
R8833:Spata17 UTSW 1 186,915,436 (GRCm39) missense probably damaging 1.00
R9288:Spata17 UTSW 1 186,844,756 (GRCm39) missense possibly damaging 0.85
R9481:Spata17 UTSW 1 186,844,756 (GRCm39) missense possibly damaging 0.85
R9588:Spata17 UTSW 1 186,849,471 (GRCm39) missense possibly damaging 0.91
V7732:Spata17 UTSW 1 186,780,677 (GRCm39) missense possibly damaging 0.53
X0027:Spata17 UTSW 1 186,926,156 (GRCm39) missense probably damaging 0.97
Z1177:Spata17 UTSW 1 186,872,626 (GRCm39) nonsense probably null
Z1177:Spata17 UTSW 1 186,849,525 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGCACTGTCACAGGCCAATC -3'
(R):5'- GCACCCTTGATTTTGATGGATG -3'

Sequencing Primer
(F):5'- CACGAAATTGAACTGGAAGTAGTGTC -3'
(R):5'- GGATGTGCCTGATCATTGCCC -3'
Posted On 2016-03-17