Incidental Mutation 'R4894:Rag2'
ID 377468
Institutional Source Beutler Lab
Gene Symbol Rag2
Ensembl Gene ENSMUSG00000032864
Gene Name recombination activating gene 2
Synonyms Rag-2
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4894 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 101455063-101462874 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101460022 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 111 (S111P)
Ref Sequence ENSEMBL: ENSMUSP00000106858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044031] [ENSMUST00000099682] [ENSMUST00000111227] [ENSMUST00000111231] [ENSMUST00000128898] [ENSMUST00000160037] [ENSMUST00000160722]
AlphaFold P21784
Predicted Effect probably damaging
Transcript: ENSMUST00000044031
AA Change: S111P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038204
Gene: ENSMUSG00000032864
AA Change: S111P

DomainStartEndE-ValueType
Pfam:RAG2 51 389 3.5e-179 PFAM
Pfam:RAG2_PHD 414 491 7.2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099682
Predicted Effect probably damaging
Transcript: ENSMUST00000111227
AA Change: S111P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106858
Gene: ENSMUSG00000032864
AA Change: S111P

DomainStartEndE-ValueType
Pfam:RAG2 51 389 6.7e-193 PFAM
Pfam:RAG2_PHD 414 491 1.1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111231
Predicted Effect probably benign
Transcript: ENSMUST00000128898
Predicted Effect probably benign
Transcript: ENSMUST00000160037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177007
Predicted Effect probably benign
Transcript: ENSMUST00000160722
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in the initiation of V(D)J recombination during B and T cell development. This protein forms a complex with the product of the adjacent recombination activating gene 1, and this complex can form double-strand breaks by cleaving DNA at conserved recombination signal sequences. The recombination activating gene 1 component is thought to contain most of the catalytic activity, while the N-terminal of the recombination activating gene 2 component is thought to form a six-bladed propeller in the active core that serves as a binding scaffold for the tight association of the complex with DNA. A C-terminal plant homeodomain finger-like motif in this protein is necessary for interactions with chromatin components, specifically with histone H3 that is trimethylated at lysine 4. Mutations in this gene cause Omenn syndrome, a form of severe combined immunodeficiency associated with autoimmune-like symptoms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of T and B cell maturation at the CD4-8- thymocyte or B220+/CD43+pro-B cell stage due to inability to undergo V(D)J recombination. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted(14)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,609,975 (GRCm39) Y176* probably null Het
Akap13 T A 7: 75,375,068 (GRCm39) M1900K possibly damaging Het
Ankrd36 A G 11: 5,585,332 (GRCm39) E381G probably damaging Het
Ap3s1 T C 18: 46,891,183 (GRCm39) probably null Het
Cacna1e G T 1: 154,364,551 (GRCm39) S341* probably null Het
Camk1d G A 2: 5,359,539 (GRCm39) S161L probably damaging Het
Cdh23 G T 10: 60,173,630 (GRCm39) H1619Q probably benign Het
Chd7 T A 4: 8,838,629 (GRCm39) I1276N probably damaging Het
Clca3a1 A G 3: 144,719,662 (GRCm39) V436A probably damaging Het
Ctcfl G A 2: 172,959,196 (GRCm39) P177S probably benign Het
Dab2ip A G 2: 35,620,539 (GRCm39) probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Epc1 A T 18: 6,449,011 (GRCm39) S495R probably benign Het
Espl1 A G 15: 102,230,758 (GRCm39) probably null Het
Eya4 T C 10: 22,985,753 (GRCm39) E583G possibly damaging Het
Fam111a C G 19: 12,565,913 (GRCm39) T554R probably benign Het
Fbh1 A T 2: 11,767,771 (GRCm39) I359N probably damaging Het
Fer1l6 T C 15: 58,490,751 (GRCm39) C1023R probably damaging Het
Helz2 G C 2: 180,877,940 (GRCm39) P953A probably benign Het
Ifi204 G T 1: 173,587,808 (GRCm39) S117Y probably damaging Het
Ift70a1 T C 2: 75,810,088 (GRCm39) *665W probably null Het
Igfn1 G A 1: 135,882,520 (GRCm39) T2775M probably damaging Het
Igsf9 A G 1: 172,325,634 (GRCm39) T1101A probably benign Het
Ipo13 A C 4: 117,760,638 (GRCm39) I614S probably damaging Het
Ipo13 A G 4: 117,761,687 (GRCm39) I476T possibly damaging Het
Kdm2b C A 5: 123,079,030 (GRCm39) E308* probably null Het
Klhl20 A T 1: 160,937,102 (GRCm39) M91K possibly damaging Het
Klrb1f T C 6: 129,030,151 (GRCm39) F64L probably benign Het
Ldlrad3 C T 2: 101,888,293 (GRCm39) C106Y probably damaging Het
Lilra6 T C 7: 3,915,530 (GRCm39) T161A probably benign Het
Lrriq1 A T 10: 102,997,613 (GRCm39) M1334K possibly damaging Het
Mepe C G 5: 104,473,268 (GRCm39) P3R probably damaging Het
Mgat4e A G 1: 134,468,856 (GRCm39) V396A probably benign Het
Nfx1 T G 4: 40,996,877 (GRCm39) S651A probably damaging Het
Or10ak13 A T 4: 118,639,483 (GRCm39) C100S probably damaging Het
Or2w6 T C 13: 21,843,352 (GRCm39) N47S probably damaging Het
Or4c109 T C 2: 88,817,783 (GRCm39) I254M possibly damaging Het
Rai1 T A 11: 60,077,572 (GRCm39) D545E probably damaging Het
Ralgps1 A G 2: 33,033,115 (GRCm39) V498A possibly damaging Het
Rasal2 G A 1: 157,020,374 (GRCm39) S205L probably damaging Het
Rec8 T C 14: 55,862,787 (GRCm39) L582P probably damaging Het
Retn G A 8: 3,707,358 (GRCm39) R106H probably damaging Het
Rnf112 A G 11: 61,343,488 (GRCm39) L116P probably damaging Het
Rnf213 T C 11: 119,372,066 (GRCm39) Y4885H probably damaging Het
Sacm1l A G 9: 123,411,409 (GRCm39) I399M probably benign Het
Sez6 G T 11: 77,866,086 (GRCm39) G738V probably damaging Het
Spata17 A G 1: 186,872,643 (GRCm39) V56A probably benign Het
Spata31d1a A T 13: 59,849,542 (GRCm39) V862D probably damaging Het
Sptb A G 12: 76,671,768 (GRCm39) probably null Het
Srpk2 C A 5: 23,750,527 (GRCm39) G59W probably damaging Het
Tyro3 T C 2: 119,632,779 (GRCm39) S96P probably damaging Het
Ube2v1 A G 2: 167,452,280 (GRCm39) S108P probably damaging Het
Usp2 C T 9: 43,987,125 (GRCm39) S141L probably benign Het
Vamp5 T C 6: 72,347,181 (GRCm39) D46G possibly damaging Het
Vmn1r23 T A 6: 57,903,310 (GRCm39) Q156L probably benign Het
Vmn2r6 C T 3: 64,454,829 (GRCm39) S490N probably benign Het
Vps39 A T 2: 120,183,440 (GRCm39) I10N probably damaging Het
Vwf C T 6: 125,622,897 (GRCm39) Q1755* probably null Het
Wdfy4 A T 14: 32,877,717 (GRCm39) H82Q probably benign Het
Wdr24 T C 17: 26,045,101 (GRCm39) Y279H probably damaging Het
Wdr72 A G 9: 74,117,843 (GRCm39) T852A probably benign Het
Zfp1 T A 8: 112,396,355 (GRCm39) C92* probably null Het
Zfp1004 T A 2: 150,033,899 (GRCm39) C104* probably null Het
Zfp426 A T 9: 20,386,369 (GRCm39) probably benign Het
Zfp442 C T 2: 150,253,130 (GRCm39) probably null Het
Zfp74 T C 7: 29,635,470 (GRCm39) probably benign Het
Other mutations in Rag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Rag2 APN 2 101,460,962 (GRCm39) missense probably benign 0.00
IGL01358:Rag2 APN 2 101,460,365 (GRCm39) missense possibly damaging 0.95
IGL01774:Rag2 APN 2 101,460,392 (GRCm39) missense probably damaging 1.00
IGL02267:Rag2 APN 2 101,460,376 (GRCm39) missense probably damaging 1.00
IGL02507:Rag2 APN 2 101,461,055 (GRCm39) missense probably damaging 0.99
IGL02615:Rag2 APN 2 101,459,913 (GRCm39) nonsense probably null
IGL02690:Rag2 APN 2 101,459,839 (GRCm39) missense probably benign 0.00
IGL03087:Rag2 APN 2 101,460,559 (GRCm39) missense probably benign 0.00
IGL03261:Rag2 APN 2 101,460,608 (GRCm39) missense probably damaging 0.96
billfold UTSW 2 101,461,118 (GRCm39) missense probably damaging 1.00
Brag UTSW 2 101,460,040 (GRCm39) missense probably damaging 1.00
excambiar UTSW 2 101,461,121 (GRCm39) missense probably damaging 0.99
picker UTSW 2 101,460,419 (GRCm39) missense probably damaging 1.00
snowcock UTSW 2 101,460,948 (GRCm39) missense probably damaging 1.00
woodcock UTSW 2 101,460,464 (GRCm39) missense probably damaging 0.98
R0266:Rag2 UTSW 2 101,460,948 (GRCm39) missense probably damaging 1.00
R0284:Rag2 UTSW 2 101,460,464 (GRCm39) missense probably damaging 0.98
R1250:Rag2 UTSW 2 101,460,784 (GRCm39) missense probably damaging 0.96
R1520:Rag2 UTSW 2 101,460,476 (GRCm39) missense probably damaging 0.99
R1641:Rag2 UTSW 2 101,459,960 (GRCm39) missense probably benign 0.22
R2260:Rag2 UTSW 2 101,460,583 (GRCm39) missense probably benign 0.00
R2571:Rag2 UTSW 2 101,460,312 (GRCm39) missense probably damaging 0.99
R3441:Rag2 UTSW 2 101,460,645 (GRCm39) missense probably damaging 0.99
R3752:Rag2 UTSW 2 101,461,121 (GRCm39) missense probably damaging 0.99
R5197:Rag2 UTSW 2 101,461,085 (GRCm39) missense probably damaging 1.00
R5236:Rag2 UTSW 2 101,460,005 (GRCm39) missense probably damaging 1.00
R6815:Rag2 UTSW 2 101,460,900 (GRCm39) missense probably damaging 0.99
R7365:Rag2 UTSW 2 101,461,118 (GRCm39) missense probably damaging 1.00
R7917:Rag2 UTSW 2 101,460,040 (GRCm39) missense probably damaging 1.00
R9026:Rag2 UTSW 2 101,460,494 (GRCm39) missense possibly damaging 0.46
R9243:Rag2 UTSW 2 101,460,419 (GRCm39) missense probably damaging 1.00
R9280:Rag2 UTSW 2 101,460,145 (GRCm39) missense probably benign 0.05
R9333:Rag2 UTSW 2 101,460,752 (GRCm39) missense probably benign 0.01
R9500:Rag2 UTSW 2 101,461,217 (GRCm39) missense probably damaging 1.00
X0027:Rag2 UTSW 2 101,460,718 (GRCm39) missense probably damaging 1.00
Z31818:Rag2 UTSW 2 101,461,150 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTAAGAGATCCTGTCCTACTG -3'
(R):5'- TAGGCAGTCAGCTACACTATTCC -3'

Sequencing Primer
(F):5'- GTCCTACTGGAGTCTTTCATTTTG -3'
(R):5'- AGCTACACTATTCCATTTTTCTGTGG -3'
Posted On 2016-03-17