Incidental Mutation 'R4894:Rag2'
ID377468
Institutional Source Beutler Lab
Gene Symbol Rag2
Ensembl Gene ENSMUSG00000032864
Gene Namerecombination activating gene 2
SynonymsRag-2
Accession Numbers

MGI:97849

Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R4894 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location101624718-101632529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101629677 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 111 (S111P)
Ref Sequence ENSEMBL: ENSMUSP00000106858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044031] [ENSMUST00000099682] [ENSMUST00000111227] [ENSMUST00000111231] [ENSMUST00000128898] [ENSMUST00000160037] [ENSMUST00000160722]
Predicted Effect probably damaging
Transcript: ENSMUST00000044031
AA Change: S111P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038204
Gene: ENSMUSG00000032864
AA Change: S111P

DomainStartEndE-ValueType
Pfam:RAG2 51 389 3.5e-179 PFAM
Pfam:RAG2_PHD 414 491 7.2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099682
Predicted Effect probably damaging
Transcript: ENSMUST00000111227
AA Change: S111P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106858
Gene: ENSMUSG00000032864
AA Change: S111P

DomainStartEndE-ValueType
Pfam:RAG2 51 389 6.7e-193 PFAM
Pfam:RAG2_PHD 414 491 1.1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111231
Predicted Effect probably benign
Transcript: ENSMUST00000128898
Predicted Effect probably benign
Transcript: ENSMUST00000160037
Predicted Effect probably benign
Transcript: ENSMUST00000160722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177171
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in the initiation of V(D)J recombination during B and T cell development. This protein forms a complex with the product of the adjacent recombination activating gene 1, and this complex can form double-strand breaks by cleaving DNA at conserved recombination signal sequences. The recombination activating gene 1 component is thought to contain most of the catalytic activity, while the N-terminal of the recombination activating gene 2 component is thought to form a six-bladed propeller in the active core that serves as a binding scaffold for the tight association of the complex with DNA. A C-terminal plant homeodomain finger-like motif in this protein is necessary for interactions with chromatin components, specifically with histone H3 that is trimethylated at lysine 4. Mutations in this gene cause Omenn syndrome, a form of severe combined immunodeficiency associated with autoimmune-like symptoms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of T and B cell maturation at the CD4-8- thymocyte or B220+/CD43+pro-B cell stage due to inability to undergo V(D)J recombination. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted(14)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,299,084 Y176* probably null Het
Akap13 T A 7: 75,725,320 M1900K possibly damaging Het
Ankrd36 A G 11: 5,635,332 E381G probably damaging Het
Ap3s1 T C 18: 46,758,116 probably null Het
Cacna1e G T 1: 154,488,805 S341* probably null Het
Camk1d G A 2: 5,354,728 S161L probably damaging Het
Cdh23 G T 10: 60,337,851 H1619Q probably benign Het
Chd7 T A 4: 8,838,629 I1276N probably damaging Het
Clca1 A G 3: 145,013,901 V436A probably damaging Het
Ctcfl G A 2: 173,117,403 P177S probably benign Het
Dab2ip A G 2: 35,730,527 probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epc1 A T 18: 6,449,011 S495R probably benign Het
Espl1 A G 15: 102,322,323 probably null Het
Eya4 T C 10: 23,109,854 E583G possibly damaging Het
Fam111a C G 19: 12,588,549 T554R probably benign Het
Fbxo18 A T 2: 11,762,960 I359N probably damaging Het
Fer1l6 T C 15: 58,618,902 C1023R probably damaging Het
Gm14139 T A 2: 150,191,979 C104* probably null Het
Helz2 G C 2: 181,236,147 P953A probably benign Het
Ifi204 G T 1: 173,760,242 S117Y probably damaging Het
Igfn1 G A 1: 135,954,782 T2775M probably damaging Het
Igsf9 A G 1: 172,498,067 T1101A probably benign Het
Ipo13 A C 4: 117,903,441 I614S probably damaging Het
Ipo13 A G 4: 117,904,490 I476T possibly damaging Het
Kdm2b C A 5: 122,940,967 E308* probably null Het
Klhl20 A T 1: 161,109,532 M91K possibly damaging Het
Klrb1f T C 6: 129,053,188 F64L probably benign Het
Ldlrad3 C T 2: 102,057,948 C106Y probably damaging Het
Lilra6 T C 7: 3,912,531 T161A probably benign Het
Lrriq1 A T 10: 103,161,752 M1334K possibly damaging Het
Mepe C G 5: 104,325,402 P3R probably damaging Het
Mgat4e A G 1: 134,541,118 V396A probably benign Het
Nfx1 T G 4: 40,996,877 S651A probably damaging Het
Olfr1214 T C 2: 88,987,439 I254M possibly damaging Het
Olfr1337 A T 4: 118,782,286 C100S probably damaging Het
Olfr1361 T C 13: 21,659,182 N47S probably damaging Het
Rai1 T A 11: 60,186,746 D545E probably damaging Het
Ralgps1 A G 2: 33,143,103 V498A possibly damaging Het
Rasal2 G A 1: 157,192,804 S205L probably damaging Het
Rec8 T C 14: 55,625,330 L582P probably damaging Het
Retn G A 8: 3,657,358 R106H probably damaging Het
Rnf112 A G 11: 61,452,662 L116P probably damaging Het
Rnf213 T C 11: 119,481,240 Y4885H probably damaging Het
Sacm1l A G 9: 123,582,344 I399M probably benign Het
Sez6 G T 11: 77,975,260 G738V probably damaging Het
Spata17 A G 1: 187,140,446 V56A probably benign Het
Spata31d1a A T 13: 59,701,728 V862D probably damaging Het
Sptb A G 12: 76,624,994 probably null Het
Srpk2 C A 5: 23,545,529 G59W probably damaging Het
Ttc30a1 T C 2: 75,979,744 *665W probably null Het
Tyro3 T C 2: 119,802,298 S96P probably damaging Het
Ube2v1 A G 2: 167,610,360 S108P probably damaging Het
Usp2 C T 9: 44,075,828 S141L probably benign Het
Vamp5 T C 6: 72,370,198 D46G possibly damaging Het
Vmn1r23 T A 6: 57,926,325 Q156L probably benign Het
Vmn2r6 C T 3: 64,547,408 S490N probably benign Het
Vps39 A T 2: 120,352,959 I10N probably damaging Het
Vwf C T 6: 125,645,934 Q1755* probably null Het
Wdfy4 A T 14: 33,155,760 H82Q probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Wdr72 A G 9: 74,210,561 T852A probably benign Het
Zfp1 T A 8: 111,669,723 C92* probably null Het
Zfp426 A T 9: 20,475,073 probably benign Het
Zfp442 C T 2: 150,411,210 probably null Het
Zfp74 T C 7: 29,936,045 probably benign Het
Other mutations in Rag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Rag2 APN 2 101630617 missense probably benign 0.00
IGL01358:Rag2 APN 2 101630020 missense possibly damaging 0.95
IGL01774:Rag2 APN 2 101630047 missense probably damaging 1.00
IGL02267:Rag2 APN 2 101630031 missense probably damaging 1.00
IGL02507:Rag2 APN 2 101630710 missense probably damaging 0.99
IGL02615:Rag2 APN 2 101629568 nonsense probably null
IGL02690:Rag2 APN 2 101629494 missense probably benign 0.00
IGL03087:Rag2 APN 2 101630214 missense probably benign 0.00
IGL03261:Rag2 APN 2 101630263 missense probably damaging 0.96
billfold UTSW 2 101630773 missense probably damaging 1.00
excambiar UTSW 2 101630776 missense probably damaging 0.99
snowcock UTSW 2 101630603 missense probably damaging 1.00
woodcock UTSW 2 101630119 missense probably damaging 0.98
R0266:Rag2 UTSW 2 101630603 missense probably damaging 1.00
R0284:Rag2 UTSW 2 101630119 missense probably damaging 0.98
R1250:Rag2 UTSW 2 101630439 missense probably damaging 0.96
R1520:Rag2 UTSW 2 101630131 missense probably damaging 0.99
R1641:Rag2 UTSW 2 101629615 missense probably benign 0.22
R2260:Rag2 UTSW 2 101630238 missense probably benign 0.00
R2571:Rag2 UTSW 2 101629967 missense probably damaging 0.99
R3441:Rag2 UTSW 2 101630300 missense probably damaging 0.99
R3752:Rag2 UTSW 2 101630776 missense probably damaging 0.99
R5197:Rag2 UTSW 2 101630740 missense probably damaging 1.00
R5236:Rag2 UTSW 2 101629660 missense probably damaging 1.00
R6815:Rag2 UTSW 2 101630555 missense probably damaging 0.99
R7365:Rag2 UTSW 2 101630773 missense probably damaging 1.00
R7917:Rag2 UTSW 2 101629695 missense probably damaging 1.00
X0027:Rag2 UTSW 2 101630373 missense probably damaging 1.00
Z31818:Rag2 UTSW 2 101630805 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTAAGAGATCCTGTCCTACTG -3'
(R):5'- TAGGCAGTCAGCTACACTATTCC -3'

Sequencing Primer
(F):5'- GTCCTACTGGAGTCTTTCATTTTG -3'
(R):5'- AGCTACACTATTCCATTTTTCTGTGG -3'
Posted On2016-03-17