Mutagenetix > Incidental Mutation

Incidental Mutation 'R4894:Clca1'

377477

Institutional Source

Beutler Lab

Gene Symbol

Clca1

Ensembl Gene

ENSMUSG00000028255

Gene Name

chloride channel accessory 1

Synonyms

gob-5, gob5, Clca3

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R4894 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

145003817-145032776 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 145013901 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 436 (V436A)

Ref Sequence

ENSEMBL: ENSMUSP00000029919 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029919]

AlphaFold

Q9D7Z6

Predicted Effect

probably damaging
Transcript: ENSMUST00000029919
AA Change: V436A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000029919
Gene: ENSMUSG00000028255
AA Change: V436A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	285	297	N/A	INTRINSIC
VWA	305	478	5.05e-19	SMART
Blast:FN3	753	852	2e-28	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195901

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198832

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium sensitive chloride conductance protein family. To date, all members of this gene family map to the same region on chromosome 1p31-p22 and share a high degree of homology in size, sequence, and predicted structure, but differ significantly in their tissue distributions. The encoded protein is expressed as a precursor protein that is processed into two cell-surface-associated subunits, although the site at which the precursor is cleaved has not been precisely determined. The encoded protein may be involved in mediating calcium-activated chloride conductance in the intestine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit an exacerbated mucin response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf1	C	A	17: 43,299,084	Y176*	probably null	Het
Akap13	T	A	7: 75,725,320	M1900K	possibly damaging	Het
Ankrd36	A	G	11: 5,635,332	E381G	probably damaging	Het
Ap3s1	T	C	18: 46,758,116		probably null	Het
Cacna1e	G	T	1: 154,488,805	S341*	probably null	Het
Camk1d	G	A	2: 5,354,728	S161L	probably damaging	Het
Cdh23	G	T	10: 60,337,851	H1619Q	probably benign	Het
Chd7	T	A	4: 8,838,629	I1276N	probably damaging	Het
Ctcfl	G	A	2: 173,117,403	P177S	probably benign	Het
Dab2ip	A	G	2: 35,730,527		probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Epc1	A	T	18: 6,449,011	S495R	probably benign	Het
Espl1	A	G	15: 102,322,323		probably null	Het
Eya4	T	C	10: 23,109,854	E583G	possibly damaging	Het
Fam111a	C	G	19: 12,588,549	T554R	probably benign	Het
Fbxo18	A	T	2: 11,762,960	I359N	probably damaging	Het
Fer1l6	T	C	15: 58,618,902	C1023R	probably damaging	Het
Gm14139	T	A	2: 150,191,979	C104*	probably null	Het
Helz2	G	C	2: 181,236,147	P953A	probably benign	Het
Ifi204	G	T	1: 173,760,242	S117Y	probably damaging	Het
Igfn1	G	A	1: 135,954,782	T2775M	probably damaging	Het
Igsf9	A	G	1: 172,498,067	T1101A	probably benign	Het
Ipo13	A	C	4: 117,903,441	I614S	probably damaging	Het
Ipo13	A	G	4: 117,904,490	I476T	possibly damaging	Het
Kdm2b	C	A	5: 122,940,967	E308*	probably null	Het
Klhl20	A	T	1: 161,109,532	M91K	possibly damaging	Het
Klrb1f	T	C	6: 129,053,188	F64L	probably benign	Het
Ldlrad3	C	T	2: 102,057,948	C106Y	probably damaging	Het
Lilra6	T	C	7: 3,912,531	T161A	probably benign	Het
Lrriq1	A	T	10: 103,161,752	M1334K	possibly damaging	Het
Mepe	C	G	5: 104,325,402	P3R	probably damaging	Het
Mgat4e	A	G	1: 134,541,118	V396A	probably benign	Het
Nfx1	T	G	4: 40,996,877	S651A	probably damaging	Het
Olfr1214	T	C	2: 88,987,439	I254M	possibly damaging	Het
Olfr1337	A	T	4: 118,782,286	C100S	probably damaging	Het
Olfr1361	T	C	13: 21,659,182	N47S	probably damaging	Het
Rag2	T	C	2: 101,629,677	S111P	probably damaging	Het
Rai1	T	A	11: 60,186,746	D545E	probably damaging	Het
Ralgps1	A	G	2: 33,143,103	V498A	possibly damaging	Het
Rasal2	G	A	1: 157,192,804	S205L	probably damaging	Het
Rec8	T	C	14: 55,625,330	L582P	probably damaging	Het
Retn	G	A	8: 3,657,358	R106H	probably damaging	Het
Rnf112	A	G	11: 61,452,662	L116P	probably damaging	Het
Rnf213	T	C	11: 119,481,240	Y4885H	probably damaging	Het
Sacm1l	A	G	9: 123,582,344	I399M	probably benign	Het
Sez6	G	T	11: 77,975,260	G738V	probably damaging	Het
Spata17	A	G	1: 187,140,446	V56A	probably benign	Het
Spata31d1a	A	T	13: 59,701,728	V862D	probably damaging	Het
Sptb	A	G	12: 76,624,994		probably null	Het
Srpk2	C	A	5: 23,545,529	G59W	probably damaging	Het
Ttc30a1	T	C	2: 75,979,744	*665W	probably null	Het
Tyro3	T	C	2: 119,802,298	S96P	probably damaging	Het
Ube2v1	A	G	2: 167,610,360	S108P	probably damaging	Het
Usp2	C	T	9: 44,075,828	S141L	probably benign	Het
Vamp5	T	C	6: 72,370,198	D46G	possibly damaging	Het
Vmn1r23	T	A	6: 57,926,325	Q156L	probably benign	Het
Vmn2r6	C	T	3: 64,547,408	S490N	probably benign	Het
Vps39	A	T	2: 120,352,959	I10N	probably damaging	Het
Vwf	C	T	6: 125,645,934	Q1755*	probably null	Het
Wdfy4	A	T	14: 33,155,760	H82Q	probably benign	Het
Wdr24	T	C	17: 25,826,127	Y279H	probably damaging	Het
Wdr72	A	G	9: 74,210,561	T852A	probably benign	Het
Zfp1	T	A	8: 111,669,723	C92*	probably null	Het
Zfp426	A	T	9: 20,475,073		probably benign	Het
Zfp442	C	T	2: 150,411,210		probably null	Het
Zfp74	T	C	7: 29,936,045		probably benign	Het

Other mutations in Clca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00664:Clca1	APN	3	145027899	missense	probably benign	0.01
IGL00862:Clca1	APN	3	145024571	missense	possibly damaging	0.89
IGL00895:Clca1	APN	3	145024596	missense	probably damaging	1.00
IGL00969:Clca1	APN	3	145008958	missense	possibly damaging	0.80
IGL01398:Clca1	APN	3	145016751	missense	possibly damaging	0.81
IGL01447:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01455:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01457:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01458:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01462:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01473:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01488:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01490:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01632:Clca1	APN	3	145027441	missense	probably damaging	1.00
IGL01896:Clca1	APN	3	145015677	missense	possibly damaging	0.79
IGL02411:Clca1	APN	3	145028002	missense	possibly damaging	0.89
IGL03156:Clca1	APN	3	145013911	missense	probably damaging	1.00
R0472:Clca1	UTSW	3	145027345	missense	probably damaging	1.00
R0571:Clca1	UTSW	3	145007789	missense	probably damaging	1.00
R0585:Clca1	UTSW	3	145032625	missense	probably benign	0.16
R0586:Clca1	UTSW	3	145032589	missense	probably benign	0.45
R0791:Clca1	UTSW	3	145004854	missense	probably benign	0.01
R1187:Clca1	UTSW	3	145009743	missense	probably benign	0.30
R1713:Clca1	UTSW	3	145024546	missense	probably benign	0.00
R1739:Clca1	UTSW	3	145007778	missense	probably benign	0.00
R2079:Clca1	UTSW	3	145007773	missense	possibly damaging	0.80
R2129:Clca1	UTSW	3	145016765	missense	probably damaging	1.00
R2178:Clca1	UTSW	3	145006102	missense	probably damaging	1.00
R2234:Clca1	UTSW	3	145009068	missense	possibly damaging	0.93
R2235:Clca1	UTSW	3	145009068	missense	possibly damaging	0.93
R2240:Clca1	UTSW	3	145008985	missense	probably damaging	1.00
R3751:Clca1	UTSW	3	145018663	missense	probably benign	0.01
R3974:Clca1	UTSW	3	145032639	missense	probably damaging	1.00
R3975:Clca1	UTSW	3	145032639	missense	probably damaging	1.00
R4409:Clca1	UTSW	3	145006027	missense	probably damaging	1.00
R4586:Clca1	UTSW	3	145016858	missense	probably damaging	1.00
R4751:Clca1	UTSW	3	145004848	missense	possibly damaging	0.89
R4909:Clca1	UTSW	3	145024563	missense	probably damaging	1.00
R4916:Clca1	UTSW	3	145015844	missense	probably benign	0.01
R4941:Clca1	UTSW	3	145015653	missense	probably damaging	1.00
R4942:Clca1	UTSW	3	145004763	missense	probably benign	0.02
R5044:Clca1	UTSW	3	145007928	splice site	probably null
R5451:Clca1	UTSW	3	145027986	missense	probably damaging	1.00
R5618:Clca1	UTSW	3	145004977	missense	probably benign	0.00
R5724:Clca1	UTSW	3	145009072	missense	probably benign	0.01
R5898:Clca1	UTSW	3	145016761	missense	possibly damaging	0.89
R6238:Clca1	UTSW	3	145008955	missense	probably benign	0.09
R6590:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6591:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6592:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6690:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6691:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6729:Clca1	UTSW	3	145005966	missense	probably damaging	1.00
R6805:Clca1	UTSW	3	145018667	missense	probably damaging	1.00
R7106:Clca1	UTSW	3	145027429	missense	probably damaging	0.98
R7121:Clca1	UTSW	3	145011806	missense	probably damaging	1.00
R7127:Clca1	UTSW	3	145006045	missense	probably damaging	1.00
R7212:Clca1	UTSW	3	145005966	missense	probably damaging	1.00
R7444:Clca1	UTSW	3	145027432	missense	probably damaging	1.00
R7446:Clca1	UTSW	3	145027427	missense	possibly damaging	0.65
R7535:Clca1	UTSW	3	145018567	missense	probably damaging	0.99
R8437:Clca1	UTSW	3	145005061	missense	probably benign	0.00
R8474:Clca1	UTSW	3	145005031	missense	possibly damaging	0.77
R8766:Clca1	UTSW	3	145009178	splice site	probably benign
R8884:Clca1	UTSW	3	145013996	missense	probably benign	0.35
R9049:Clca1	UTSW	3	145027382	missense	probably benign	0.01
R9306:Clca1	UTSW	3	145024578	missense	probably damaging	1.00
R9623:Clca1	UTSW	3	145013937	missense	probably benign	0.03
X0020:Clca1	UTSW	3	145032660	missense	possibly damaging	0.89
Z1176:Clca1	UTSW	3	145013921	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCACATGGGAGAAGCATAGCTAC -3'
(R):5'- CCAGACATCTACTTGGTCCC -3'

Sequencing Primer
(F):5'- CATAGCTACTTGGCTGAGATGACTC -3'
(R):5'- TGTCCCATGTAAAGGCAGTATCC -3'

Posted On

2016-03-17