Incidental Mutation 'R4894:Chd7'
ID 377478
Institutional Source Beutler Lab
Gene Symbol Chd7
Ensembl Gene ENSMUSG00000041235
Gene Name chromodomain helicase DNA binding protein 7
Synonyms Whi, Dz, Cyn, GENA 47, Cycn, Lda, Flo, Obt, Edy, A730019I05Rik, Todo, GENA 60, WBE1, Gena 52, Mt
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R4894 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 8690406-8867659 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 8838629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1276 (I1276N)
Ref Sequence ENSEMBL: ENSMUSP00000059079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039267] [ENSMUST00000051558] [ENSMUST00000170391]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039267
AA Change: I1276N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043903
Gene: ENSMUSG00000041235
AA Change: I1276N

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000051558
AA Change: I1276N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059079
Gene: ENSMUSG00000041235
AA Change: I1276N

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130709
Predicted Effect probably benign
Transcript: ENSMUST00000170391
SMART Domains Protein: ENSMUSP00000127007
Gene: ENSMUSG00000041235

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
BRK 586 630 3.77e-23 SMART
low complexity region 670 680 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 724 733 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 765 776 N/A INTRINSIC
low complexity region 852 871 N/A INTRINSIC
low complexity region 922 935 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein containing two chromodomains and an ATP-binding helicase domain that functions as a regulator of transcription. Mutations in this gene result in an array of development defects, including inner ear problems. Mice defective for this gene exhibit many of the clinical features of the CHARGE syndrome caused by mutations in the homologous gene in human. [provided by RefSeq, Sep 2015]
PHENOTYPE: Heterozygotes for mutations of this gene exhibit a variety of combinations of hyperactivity, circling, head-bobbing, semicircular canal defects, hearing loss, reduced size, and tail-kink. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted, other(4) Gene trapped(19) Chemically induced(9)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,609,975 (GRCm39) Y176* probably null Het
Akap13 T A 7: 75,375,068 (GRCm39) M1900K possibly damaging Het
Ankrd36 A G 11: 5,585,332 (GRCm39) E381G probably damaging Het
Ap3s1 T C 18: 46,891,183 (GRCm39) probably null Het
Cacna1e G T 1: 154,364,551 (GRCm39) S341* probably null Het
Camk1d G A 2: 5,359,539 (GRCm39) S161L probably damaging Het
Cdh23 G T 10: 60,173,630 (GRCm39) H1619Q probably benign Het
Clca3a1 A G 3: 144,719,662 (GRCm39) V436A probably damaging Het
Ctcfl G A 2: 172,959,196 (GRCm39) P177S probably benign Het
Dab2ip A G 2: 35,620,539 (GRCm39) probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Epc1 A T 18: 6,449,011 (GRCm39) S495R probably benign Het
Espl1 A G 15: 102,230,758 (GRCm39) probably null Het
Eya4 T C 10: 22,985,753 (GRCm39) E583G possibly damaging Het
Fam111a C G 19: 12,565,913 (GRCm39) T554R probably benign Het
Fbh1 A T 2: 11,767,771 (GRCm39) I359N probably damaging Het
Fer1l6 T C 15: 58,490,751 (GRCm39) C1023R probably damaging Het
Helz2 G C 2: 180,877,940 (GRCm39) P953A probably benign Het
Ifi204 G T 1: 173,587,808 (GRCm39) S117Y probably damaging Het
Ift70a1 T C 2: 75,810,088 (GRCm39) *665W probably null Het
Igfn1 G A 1: 135,882,520 (GRCm39) T2775M probably damaging Het
Igsf9 A G 1: 172,325,634 (GRCm39) T1101A probably benign Het
Ipo13 A C 4: 117,760,638 (GRCm39) I614S probably damaging Het
Ipo13 A G 4: 117,761,687 (GRCm39) I476T possibly damaging Het
Kdm2b C A 5: 123,079,030 (GRCm39) E308* probably null Het
Klhl20 A T 1: 160,937,102 (GRCm39) M91K possibly damaging Het
Klrb1f T C 6: 129,030,151 (GRCm39) F64L probably benign Het
Ldlrad3 C T 2: 101,888,293 (GRCm39) C106Y probably damaging Het
Lilra6 T C 7: 3,915,530 (GRCm39) T161A probably benign Het
Lrriq1 A T 10: 102,997,613 (GRCm39) M1334K possibly damaging Het
Mepe C G 5: 104,473,268 (GRCm39) P3R probably damaging Het
Mgat4e A G 1: 134,468,856 (GRCm39) V396A probably benign Het
Nfx1 T G 4: 40,996,877 (GRCm39) S651A probably damaging Het
Or10ak13 A T 4: 118,639,483 (GRCm39) C100S probably damaging Het
Or2w6 T C 13: 21,843,352 (GRCm39) N47S probably damaging Het
Or4c109 T C 2: 88,817,783 (GRCm39) I254M possibly damaging Het
Rag2 T C 2: 101,460,022 (GRCm39) S111P probably damaging Het
Rai1 T A 11: 60,077,572 (GRCm39) D545E probably damaging Het
Ralgps1 A G 2: 33,033,115 (GRCm39) V498A possibly damaging Het
Rasal2 G A 1: 157,020,374 (GRCm39) S205L probably damaging Het
Rec8 T C 14: 55,862,787 (GRCm39) L582P probably damaging Het
Retn G A 8: 3,707,358 (GRCm39) R106H probably damaging Het
Rnf112 A G 11: 61,343,488 (GRCm39) L116P probably damaging Het
Rnf213 T C 11: 119,372,066 (GRCm39) Y4885H probably damaging Het
Sacm1l A G 9: 123,411,409 (GRCm39) I399M probably benign Het
Sez6 G T 11: 77,866,086 (GRCm39) G738V probably damaging Het
Spata17 A G 1: 186,872,643 (GRCm39) V56A probably benign Het
Spata31d1a A T 13: 59,849,542 (GRCm39) V862D probably damaging Het
Sptb A G 12: 76,671,768 (GRCm39) probably null Het
Srpk2 C A 5: 23,750,527 (GRCm39) G59W probably damaging Het
Tyro3 T C 2: 119,632,779 (GRCm39) S96P probably damaging Het
Ube2v1 A G 2: 167,452,280 (GRCm39) S108P probably damaging Het
Usp2 C T 9: 43,987,125 (GRCm39) S141L probably benign Het
Vamp5 T C 6: 72,347,181 (GRCm39) D46G possibly damaging Het
Vmn1r23 T A 6: 57,903,310 (GRCm39) Q156L probably benign Het
Vmn2r6 C T 3: 64,454,829 (GRCm39) S490N probably benign Het
Vps39 A T 2: 120,183,440 (GRCm39) I10N probably damaging Het
Vwf C T 6: 125,622,897 (GRCm39) Q1755* probably null Het
Wdfy4 A T 14: 32,877,717 (GRCm39) H82Q probably benign Het
Wdr24 T C 17: 26,045,101 (GRCm39) Y279H probably damaging Het
Wdr72 A G 9: 74,117,843 (GRCm39) T852A probably benign Het
Zfp1 T A 8: 112,396,355 (GRCm39) C92* probably null Het
Zfp1004 T A 2: 150,033,899 (GRCm39) C104* probably null Het
Zfp426 A T 9: 20,386,369 (GRCm39) probably benign Het
Zfp442 C T 2: 150,253,130 (GRCm39) probably null Het
Zfp74 T C 7: 29,635,470 (GRCm39) probably benign Het
Other mutations in Chd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Chd7 APN 4 8,859,106 (GRCm39) missense probably damaging 1.00
IGL00510:Chd7 APN 4 8,801,404 (GRCm39) missense probably damaging 1.00
IGL00741:Chd7 APN 4 8,839,454 (GRCm39) missense probably damaging 1.00
IGL00796:Chd7 APN 4 8,847,271 (GRCm39) missense possibly damaging 0.95
IGL00907:Chd7 APN 4 8,840,435 (GRCm39) missense probably damaging 0.98
IGL00930:Chd7 APN 4 8,805,181 (GRCm39) missense probably damaging 1.00
IGL01542:Chd7 APN 4 8,859,285 (GRCm39) missense possibly damaging 0.71
IGL01602:Chd7 APN 4 8,833,834 (GRCm39) missense probably damaging 1.00
IGL01605:Chd7 APN 4 8,833,834 (GRCm39) missense probably damaging 1.00
IGL01670:Chd7 APN 4 8,827,033 (GRCm39) missense probably damaging 0.98
IGL02434:Chd7 APN 4 8,752,145 (GRCm39) missense probably benign 0.00
IGL02531:Chd7 APN 4 8,854,134 (GRCm39) missense probably damaging 1.00
IGL02626:Chd7 APN 4 8,826,519 (GRCm39) missense probably damaging 1.00
IGL02961:Chd7 APN 4 8,751,542 (GRCm39) missense probably damaging 1.00
IGL02972:Chd7 APN 4 8,855,174 (GRCm39) missense probably benign 0.30
IGL03329:Chd7 APN 4 8,841,108 (GRCm39) missense probably damaging 1.00
Fili UTSW 4 8,839,523 (GRCm39) missense probably damaging 1.00
D4043:Chd7 UTSW 4 8,862,650 (GRCm39) missense probably damaging 1.00
IGL02991:Chd7 UTSW 4 8,828,398 (GRCm39) missense possibly damaging 0.91
PIT4466001:Chd7 UTSW 4 8,753,101 (GRCm39) missense unknown
PIT4472001:Chd7 UTSW 4 8,753,101 (GRCm39) missense unknown
R0157:Chd7 UTSW 4 8,833,759 (GRCm39) missense probably damaging 1.00
R0179:Chd7 UTSW 4 8,862,516 (GRCm39) missense probably benign 0.22
R0240:Chd7 UTSW 4 8,852,670 (GRCm39) unclassified probably benign
R0388:Chd7 UTSW 4 8,854,560 (GRCm39) missense probably benign 0.27
R0462:Chd7 UTSW 4 8,850,821 (GRCm39) missense probably damaging 1.00
R0512:Chd7 UTSW 4 8,805,139 (GRCm39) intron probably benign
R0657:Chd7 UTSW 4 8,753,141 (GRCm39) missense probably damaging 1.00
R0799:Chd7 UTSW 4 8,801,310 (GRCm39) intron probably benign
R0885:Chd7 UTSW 4 8,866,432 (GRCm39) missense probably damaging 1.00
R1056:Chd7 UTSW 4 8,822,402 (GRCm39) missense possibly damaging 0.50
R1086:Chd7 UTSW 4 8,866,458 (GRCm39) missense probably benign 0.04
R1353:Chd7 UTSW 4 8,839,556 (GRCm39) missense probably damaging 0.99
R1466:Chd7 UTSW 4 8,840,561 (GRCm39) splice site probably null
R1466:Chd7 UTSW 4 8,840,561 (GRCm39) splice site probably null
R1605:Chd7 UTSW 4 8,844,675 (GRCm39) missense probably damaging 1.00
R1693:Chd7 UTSW 4 8,864,307 (GRCm39) critical splice donor site probably null
R1695:Chd7 UTSW 4 8,833,960 (GRCm39) missense probably damaging 1.00
R1938:Chd7 UTSW 4 8,847,200 (GRCm39) missense probably damaging 1.00
R1964:Chd7 UTSW 4 8,865,978 (GRCm39) missense probably damaging 0.96
R2020:Chd7 UTSW 4 8,855,226 (GRCm39) missense probably benign 0.00
R2134:Chd7 UTSW 4 8,753,147 (GRCm39) missense probably damaging 0.99
R2171:Chd7 UTSW 4 8,752,424 (GRCm39) missense probably damaging 1.00
R2271:Chd7 UTSW 4 8,785,532 (GRCm39) missense probably damaging 1.00
R2300:Chd7 UTSW 4 8,855,241 (GRCm39) missense probably benign 0.02
R2355:Chd7 UTSW 4 8,801,350 (GRCm39) missense possibly damaging 0.95
R3153:Chd7 UTSW 4 8,855,174 (GRCm39) missense probably benign 0.30
R3430:Chd7 UTSW 4 8,844,517 (GRCm39) missense probably damaging 0.99
R3746:Chd7 UTSW 4 8,752,537 (GRCm39) missense probably damaging 1.00
R4118:Chd7 UTSW 4 8,865,831 (GRCm39) missense probably damaging 1.00
R4119:Chd7 UTSW 4 8,785,658 (GRCm39) intron probably benign
R4332:Chd7 UTSW 4 8,854,143 (GRCm39) missense probably damaging 1.00
R4402:Chd7 UTSW 4 8,866,353 (GRCm39) missense possibly damaging 0.61
R4571:Chd7 UTSW 4 8,866,217 (GRCm39) missense probably benign 0.09
R4722:Chd7 UTSW 4 8,822,445 (GRCm39) missense probably damaging 1.00
R4821:Chd7 UTSW 4 8,844,706 (GRCm39) missense probably damaging 1.00
R5205:Chd7 UTSW 4 8,752,509 (GRCm39) missense possibly damaging 0.60
R5344:Chd7 UTSW 4 8,844,417 (GRCm39) missense probably damaging 1.00
R5484:Chd7 UTSW 4 8,828,258 (GRCm39) missense probably damaging 1.00
R5578:Chd7 UTSW 4 8,847,149 (GRCm39) missense probably benign 0.09
R5583:Chd7 UTSW 4 8,752,473 (GRCm39) missense probably damaging 1.00
R5888:Chd7 UTSW 4 8,866,382 (GRCm39) missense probably damaging 0.98
R5905:Chd7 UTSW 4 8,840,553 (GRCm39) missense possibly damaging 0.91
R6091:Chd7 UTSW 4 8,751,875 (GRCm39) missense probably damaging 0.99
R6126:Chd7 UTSW 4 8,826,482 (GRCm39) missense probably damaging 1.00
R6399:Chd7 UTSW 4 8,828,274 (GRCm39) missense probably damaging 1.00
R6751:Chd7 UTSW 4 8,833,866 (GRCm39) missense probably damaging 1.00
R6810:Chd7 UTSW 4 8,839,523 (GRCm39) missense probably damaging 1.00
R6868:Chd7 UTSW 4 8,811,501 (GRCm39) splice site probably null
R6952:Chd7 UTSW 4 8,856,797 (GRCm39) missense probably damaging 1.00
R6986:Chd7 UTSW 4 8,859,285 (GRCm39) missense possibly damaging 0.71
R6990:Chd7 UTSW 4 8,844,525 (GRCm39) missense probably benign 0.28
R7139:Chd7 UTSW 4 8,865,865 (GRCm39) missense probably benign 0.00
R7288:Chd7 UTSW 4 8,847,093 (GRCm39) missense possibly damaging 0.92
R7355:Chd7 UTSW 4 8,752,196 (GRCm39) missense unknown
R7452:Chd7 UTSW 4 8,854,731 (GRCm39) missense probably benign 0.03
R7471:Chd7 UTSW 4 8,859,197 (GRCm39) missense probably damaging 0.96
R7588:Chd7 UTSW 4 8,864,039 (GRCm39) missense probably damaging 1.00
R7711:Chd7 UTSW 4 8,805,234 (GRCm39) missense probably benign 0.00
R7744:Chd7 UTSW 4 8,862,485 (GRCm39) splice site probably null
R7842:Chd7 UTSW 4 8,854,115 (GRCm39) missense probably benign 0.01
R7883:Chd7 UTSW 4 8,826,504 (GRCm39) missense probably damaging 1.00
R7934:Chd7 UTSW 4 8,854,121 (GRCm39) missense probably benign 0.00
R7983:Chd7 UTSW 4 8,844,609 (GRCm39) missense possibly damaging 0.47
R7983:Chd7 UTSW 4 8,752,628 (GRCm39) missense unknown
R8022:Chd7 UTSW 4 8,751,605 (GRCm39) missense unknown
R8161:Chd7 UTSW 4 8,855,038 (GRCm39) missense probably damaging 1.00
R8274:Chd7 UTSW 4 8,839,432 (GRCm39) missense probably damaging 1.00
R8278:Chd7 UTSW 4 8,862,485 (GRCm39) splice site probably null
R8358:Chd7 UTSW 4 8,839,529 (GRCm39) missense probably damaging 1.00
R8464:Chd7 UTSW 4 8,811,465 (GRCm39) missense probably benign 0.06
R8483:Chd7 UTSW 4 8,822,412 (GRCm39) missense possibly damaging 0.65
R8507:Chd7 UTSW 4 8,858,675 (GRCm39) missense probably damaging 1.00
R8535:Chd7 UTSW 4 8,859,211 (GRCm39) missense possibly damaging 0.92
R8695:Chd7 UTSW 4 8,850,812 (GRCm39) missense probably damaging 1.00
R8700:Chd7 UTSW 4 8,833,892 (GRCm39) missense probably damaging 1.00
R8755:Chd7 UTSW 4 8,866,069 (GRCm39) missense probably benign 0.31
R8774:Chd7 UTSW 4 8,854,692 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Chd7 UTSW 4 8,854,692 (GRCm39) missense probably damaging 1.00
R8796:Chd7 UTSW 4 8,838,691 (GRCm39) missense probably damaging 1.00
R8992:Chd7 UTSW 4 8,839,589 (GRCm39) missense probably damaging 1.00
R9018:Chd7 UTSW 4 8,847,083 (GRCm39) missense possibly damaging 0.88
R9122:Chd7 UTSW 4 8,840,510 (GRCm39) missense possibly damaging 0.77
R9131:Chd7 UTSW 4 8,785,642 (GRCm39) missense
R9182:Chd7 UTSW 4 8,838,737 (GRCm39) missense probably damaging 1.00
R9227:Chd7 UTSW 4 8,805,272 (GRCm39) missense probably benign 0.03
R9254:Chd7 UTSW 4 8,752,210 (GRCm39) missense unknown
R9379:Chd7 UTSW 4 8,752,210 (GRCm39) missense unknown
R9388:Chd7 UTSW 4 8,865,756 (GRCm39) missense possibly damaging 0.89
R9455:Chd7 UTSW 4 8,752,061 (GRCm39) missense unknown
R9531:Chd7 UTSW 4 8,858,489 (GRCm39) missense
R9577:Chd7 UTSW 4 8,752,964 (GRCm39) missense unknown
R9634:Chd7 UTSW 4 8,832,499 (GRCm39) missense probably damaging 1.00
Z1176:Chd7 UTSW 4 8,844,313 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGGCTTCCTGCTCTTAC -3'
(R):5'- TGCCACCTCTACTGTAAATGTCAC -3'

Sequencing Primer
(F):5'- CCTGCTCTTACATGTGAATGGG -3'
(R):5'- GTGACTCACACCGCATCCTG -3'
Posted On 2016-03-17