Incidental Mutation 'R4894:Nfx1'
ID377479
Institutional Source Beutler Lab
Gene Symbol Nfx1
Ensembl Gene ENSMUSG00000028423
Gene Namenuclear transcription factor, X-box binding 1
Synonyms1300017N15Rik, Tex42, 3000003M19Rik, TEG-42
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.677) question?
Stock #R4894 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location40970906-41025993 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 40996877 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 651 (S651A)
Ref Sequence ENSEMBL: ENSMUSP00000095747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030133] [ENSMUST00000091614] [ENSMUST00000098143]
Predicted Effect probably damaging
Transcript: ENSMUST00000030133
AA Change: S651A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030133
Gene: ENSMUSG00000028423
AA Change: S651A

DomainStartEndE-ValueType
RING 352 402 3.91e-2 SMART
ZnF_NFX 447 465 1.23e-3 SMART
ZnF_NFX 500 519 6.16e-4 SMART
ZnF_NFX 561 580 2e-3 SMART
ZnF_NFX 626 649 5.45e-5 SMART
ZnF_NFX 688 707 5.25e0 SMART
ZnF_NFX 715 734 2.92e-5 SMART
ZnF_NFX 772 791 5.25e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091614
AA Change: S651A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089203
Gene: ENSMUSG00000028423
AA Change: S651A

DomainStartEndE-ValueType
RING 352 402 3.91e-2 SMART
ZnF_NFX 447 465 1.23e-3 SMART
ZnF_NFX 500 519 6.16e-4 SMART
ZnF_NFX 561 580 2e-3 SMART
ZnF_NFX 626 649 5.45e-5 SMART
ZnF_NFX 688 707 5.25e0 SMART
ZnF_NFX 715 734 2.92e-5 SMART
ZnF_NFX 772 791 5.25e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098143
AA Change: S651A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095747
Gene: ENSMUSG00000028423
AA Change: S651A

DomainStartEndE-ValueType
RING 352 402 3.91e-2 SMART
ZnF_NFX 447 465 1.23e-3 SMART
ZnF_NFX 500 519 6.16e-4 SMART
ZnF_NFX 561 580 2e-3 SMART
ZnF_NFX 626 649 5.45e-5 SMART
ZnF_NFX 688 707 5.25e0 SMART
ZnF_NFX 715 734 2.92e-5 SMART
ZnF_NFX 772 791 5.25e0 SMART
ZnF_NFX 826 848 7.7e-5 SMART
ZnF_NFX 857 878 4.23e-2 SMART
coiled coil region 930 956 N/A INTRINSIC
R3H 977 1055 1.38e-22 SMART
low complexity region 1070 1088 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175121
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MHC class II gene expression is controlled primarily at the transcriptional level by transcription factors that bind to the X and Y boxes, two highly conserved elements in the proximal promoter of MHC class II genes. The protein encoded by this gene is a transcriptional repressor capable of binding to the conserved X box motif of HLA-DRA and other MHC class II genes in vitro. The protein may play a role in regulating the duration of an inflammatory response by limiting the period in which class II MHC molecules are induced by IFN-gamma. Three alternative splice variants, each of which encodes a different isoform, have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,299,084 Y176* probably null Het
Akap13 T A 7: 75,725,320 M1900K possibly damaging Het
Ankrd36 A G 11: 5,635,332 E381G probably damaging Het
Ap3s1 T C 18: 46,758,116 probably null Het
Cacna1e G T 1: 154,488,805 S341* probably null Het
Camk1d G A 2: 5,354,728 S161L probably damaging Het
Cdh23 G T 10: 60,337,851 H1619Q probably benign Het
Chd7 T A 4: 8,838,629 I1276N probably damaging Het
Clca1 A G 3: 145,013,901 V436A probably damaging Het
Ctcfl G A 2: 173,117,403 P177S probably benign Het
Dab2ip A G 2: 35,730,527 probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epc1 A T 18: 6,449,011 S495R probably benign Het
Espl1 A G 15: 102,322,323 probably null Het
Eya4 T C 10: 23,109,854 E583G possibly damaging Het
Fam111a C G 19: 12,588,549 T554R probably benign Het
Fbxo18 A T 2: 11,762,960 I359N probably damaging Het
Fer1l6 T C 15: 58,618,902 C1023R probably damaging Het
Gm14139 T A 2: 150,191,979 C104* probably null Het
Helz2 G C 2: 181,236,147 P953A probably benign Het
Ifi204 G T 1: 173,760,242 S117Y probably damaging Het
Igfn1 G A 1: 135,954,782 T2775M probably damaging Het
Igsf9 A G 1: 172,498,067 T1101A probably benign Het
Ipo13 A C 4: 117,903,441 I614S probably damaging Het
Ipo13 A G 4: 117,904,490 I476T possibly damaging Het
Kdm2b C A 5: 122,940,967 E308* probably null Het
Klhl20 A T 1: 161,109,532 M91K possibly damaging Het
Klrb1f T C 6: 129,053,188 F64L probably benign Het
Ldlrad3 C T 2: 102,057,948 C106Y probably damaging Het
Lilra6 T C 7: 3,912,531 T161A probably benign Het
Lrriq1 A T 10: 103,161,752 M1334K possibly damaging Het
Mepe C G 5: 104,325,402 P3R probably damaging Het
Mgat4e A G 1: 134,541,118 V396A probably benign Het
Olfr1214 T C 2: 88,987,439 I254M possibly damaging Het
Olfr1337 A T 4: 118,782,286 C100S probably damaging Het
Olfr1361 T C 13: 21,659,182 N47S probably damaging Het
Rag2 T C 2: 101,629,677 S111P probably damaging Het
Rai1 T A 11: 60,186,746 D545E probably damaging Het
Ralgps1 A G 2: 33,143,103 V498A possibly damaging Het
Rasal2 G A 1: 157,192,804 S205L probably damaging Het
Rec8 T C 14: 55,625,330 L582P probably damaging Het
Retn G A 8: 3,657,358 R106H probably damaging Het
Rnf112 A G 11: 61,452,662 L116P probably damaging Het
Rnf213 T C 11: 119,481,240 Y4885H probably damaging Het
Sacm1l A G 9: 123,582,344 I399M probably benign Het
Sez6 G T 11: 77,975,260 G738V probably damaging Het
Spata17 A G 1: 187,140,446 V56A probably benign Het
Spata31d1a A T 13: 59,701,728 V862D probably damaging Het
Sptb A G 12: 76,624,994 probably null Het
Srpk2 C A 5: 23,545,529 G59W probably damaging Het
Ttc30a1 T C 2: 75,979,744 *665W probably null Het
Tyro3 T C 2: 119,802,298 S96P probably damaging Het
Ube2v1 A G 2: 167,610,360 S108P probably damaging Het
Usp2 C T 9: 44,075,828 S141L probably benign Het
Vamp5 T C 6: 72,370,198 D46G possibly damaging Het
Vmn1r23 T A 6: 57,926,325 Q156L probably benign Het
Vmn2r6 C T 3: 64,547,408 S490N probably benign Het
Vps39 A T 2: 120,352,959 I10N probably damaging Het
Vwf C T 6: 125,645,934 Q1755* probably null Het
Wdfy4 A T 14: 33,155,760 H82Q probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Wdr72 A G 9: 74,210,561 T852A probably benign Het
Zfp1 T A 8: 111,669,723 C92* probably null Het
Zfp426 A T 9: 20,475,073 probably benign Het
Zfp442 C T 2: 150,411,210 probably null Het
Zfp74 T C 7: 29,936,045 probably benign Het
Other mutations in Nfx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Nfx1 APN 4 40977241 missense probably benign 0.00
IGL01998:Nfx1 APN 4 41004353 missense probably damaging 1.00
IGL02072:Nfx1 APN 4 41016119 missense probably benign
IGL02170:Nfx1 APN 4 41018019 missense probably damaging 1.00
IGL02188:Nfx1 APN 4 40993827 missense probably damaging 1.00
IGL02502:Nfx1 APN 4 40976345 splice site probably benign
IGL02674:Nfx1 APN 4 40999717 critical splice donor site probably null
IGL03007:Nfx1 APN 4 40984962 missense probably benign 0.02
IGL03092:Nfx1 APN 4 41024851 missense probably damaging 1.00
IGL03303:Nfx1 APN 4 41004323 splice site probably benign
K7371:Nfx1 UTSW 4 40976803 missense probably damaging 1.00
PIT4498001:Nfx1 UTSW 4 40977244 missense probably benign
R0032:Nfx1 UTSW 4 41015321 missense probably benign 0.00
R0032:Nfx1 UTSW 4 41015321 missense probably benign 0.00
R0069:Nfx1 UTSW 4 40986688 splice site probably benign
R1056:Nfx1 UTSW 4 41003057 missense probably damaging 0.97
R1449:Nfx1 UTSW 4 40976803 missense probably damaging 1.00
R1635:Nfx1 UTSW 4 40977004 missense probably benign
R1636:Nfx1 UTSW 4 41016072 splice site probably null
R1882:Nfx1 UTSW 4 41009240 missense possibly damaging 0.55
R2089:Nfx1 UTSW 4 40977004 missense probably benign
R2091:Nfx1 UTSW 4 40977004 missense probably benign
R2091:Nfx1 UTSW 4 40977004 missense probably benign
R3792:Nfx1 UTSW 4 41004357 nonsense probably null
R3793:Nfx1 UTSW 4 41004357 nonsense probably null
R4668:Nfx1 UTSW 4 40976367 missense possibly damaging 0.50
R4678:Nfx1 UTSW 4 41012070 missense probably benign 0.01
R4972:Nfx1 UTSW 4 40976375 missense probably benign 0.36
R5066:Nfx1 UTSW 4 40991868 missense probably benign
R5389:Nfx1 UTSW 4 40985000 missense probably damaging 1.00
R5429:Nfx1 UTSW 4 41004343 missense probably damaging 1.00
R5643:Nfx1 UTSW 4 40984973 missense probably null 1.00
R5644:Nfx1 UTSW 4 40984973 missense probably null 1.00
R5915:Nfx1 UTSW 4 40977285 missense probably benign 0.02
R6286:Nfx1 UTSW 4 40986728 missense probably damaging 1.00
R6393:Nfx1 UTSW 4 40976851 missense possibly damaging 0.92
R7409:Nfx1 UTSW 4 41021830 missense possibly damaging 0.64
R7523:Nfx1 UTSW 4 41016119 missense probably benign
X0025:Nfx1 UTSW 4 40976422 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGCAGGCAACATGCTAGTGC -3'
(R):5'- CATGTGGCTAAATCACAGTAGTGC -3'

Sequencing Primer
(F):5'- GCAACATGCTAGTGCCCAGC -3'
(R):5'- AGTAGTGCTGTTTCTTTCTTCACATG -3'
Posted On2016-03-17