Mutagenetix > Incidental Mutation

Incidental Mutation 'R4894:Nfx1'

377479

Institutional Source

Beutler Lab

Gene Symbol

Nfx1

Ensembl Gene

ENSMUSG00000028423

Gene Name

nuclear transcription factor, X-box binding 1

Synonyms

1300017N15Rik, Tex42, 3000003M19Rik, TEG-42

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.547) question?

Stock #

R4894 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40970906-41025993 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 40996877 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 651 (S651A)

Ref Sequence

ENSEMBL: ENSMUSP00000095747 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030133] [ENSMUST00000091614] [ENSMUST00000098143]

AlphaFold

B1AY10

Predicted Effect

probably damaging
Transcript: ENSMUST00000030133
AA Change: S651A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030133
Gene: ENSMUSG00000028423
AA Change: S651A

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000091614
AA Change: S651A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000089203
Gene: ENSMUSG00000028423
AA Change: S651A

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000098143
AA Change: S651A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095747
Gene: ENSMUSG00000028423
AA Change: S651A

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART
ZnF_NFX	826	848	7.7e-5	SMART
ZnF_NFX	857	878	4.23e-2	SMART
coiled coil region	930	956	N/A	INTRINSIC
R3H	977	1055	1.38e-22	SMART
low complexity region	1070	1088	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175121

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MHC class II gene expression is controlled primarily at the transcriptional level by transcription factors that bind to the X and Y boxes, two highly conserved elements in the proximal promoter of MHC class II genes. The protein encoded by this gene is a transcriptional repressor capable of binding to the conserved X box motif of HLA-DRA and other MHC class II genes in vitro. The protein may play a role in regulating the duration of an inflammatory response by limiting the period in which class II MHC molecules are induced by IFN-gamma. Three alternative splice variants, each of which encodes a different isoform, have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf1	C	A	17: 43,299,084	Y176*	probably null	Het
Akap13	T	A	7: 75,725,320	M1900K	possibly damaging	Het
Ankrd36	A	G	11: 5,635,332	E381G	probably damaging	Het
Ap3s1	T	C	18: 46,758,116		probably null	Het
Cacna1e	G	T	1: 154,488,805	S341*	probably null	Het
Camk1d	G	A	2: 5,354,728	S161L	probably damaging	Het
Cdh23	G	T	10: 60,337,851	H1619Q	probably benign	Het
Chd7	T	A	4: 8,838,629	I1276N	probably damaging	Het
Clca1	A	G	3: 145,013,901	V436A	probably damaging	Het
Ctcfl	G	A	2: 173,117,403	P177S	probably benign	Het
Dab2ip	A	G	2: 35,730,527		probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Epc1	A	T	18: 6,449,011	S495R	probably benign	Het
Espl1	A	G	15: 102,322,323		probably null	Het
Eya4	T	C	10: 23,109,854	E583G	possibly damaging	Het
Fam111a	C	G	19: 12,588,549	T554R	probably benign	Het
Fbxo18	A	T	2: 11,762,960	I359N	probably damaging	Het
Fer1l6	T	C	15: 58,618,902	C1023R	probably damaging	Het
Gm14139	T	A	2: 150,191,979	C104*	probably null	Het
Helz2	G	C	2: 181,236,147	P953A	probably benign	Het
Ifi204	G	T	1: 173,760,242	S117Y	probably damaging	Het
Igfn1	G	A	1: 135,954,782	T2775M	probably damaging	Het
Igsf9	A	G	1: 172,498,067	T1101A	probably benign	Het
Ipo13	A	C	4: 117,903,441	I614S	probably damaging	Het
Ipo13	A	G	4: 117,904,490	I476T	possibly damaging	Het
Kdm2b	C	A	5: 122,940,967	E308*	probably null	Het
Klhl20	A	T	1: 161,109,532	M91K	possibly damaging	Het
Klrb1f	T	C	6: 129,053,188	F64L	probably benign	Het
Ldlrad3	C	T	2: 102,057,948	C106Y	probably damaging	Het
Lilra6	T	C	7: 3,912,531	T161A	probably benign	Het
Lrriq1	A	T	10: 103,161,752	M1334K	possibly damaging	Het
Mepe	C	G	5: 104,325,402	P3R	probably damaging	Het
Mgat4e	A	G	1: 134,541,118	V396A	probably benign	Het
Olfr1214	T	C	2: 88,987,439	I254M	possibly damaging	Het
Olfr1337	A	T	4: 118,782,286	C100S	probably damaging	Het
Olfr1361	T	C	13: 21,659,182	N47S	probably damaging	Het
Rag2	T	C	2: 101,629,677	S111P	probably damaging	Het
Rai1	T	A	11: 60,186,746	D545E	probably damaging	Het
Ralgps1	A	G	2: 33,143,103	V498A	possibly damaging	Het
Rasal2	G	A	1: 157,192,804	S205L	probably damaging	Het
Rec8	T	C	14: 55,625,330	L582P	probably damaging	Het
Retn	G	A	8: 3,657,358	R106H	probably damaging	Het
Rnf112	A	G	11: 61,452,662	L116P	probably damaging	Het
Rnf213	T	C	11: 119,481,240	Y4885H	probably damaging	Het
Sacm1l	A	G	9: 123,582,344	I399M	probably benign	Het
Sez6	G	T	11: 77,975,260	G738V	probably damaging	Het
Spata17	A	G	1: 187,140,446	V56A	probably benign	Het
Spata31d1a	A	T	13: 59,701,728	V862D	probably damaging	Het
Sptb	A	G	12: 76,624,994		probably null	Het
Srpk2	C	A	5: 23,545,529	G59W	probably damaging	Het
Ttc30a1	T	C	2: 75,979,744	*665W	probably null	Het
Tyro3	T	C	2: 119,802,298	S96P	probably damaging	Het
Ube2v1	A	G	2: 167,610,360	S108P	probably damaging	Het
Usp2	C	T	9: 44,075,828	S141L	probably benign	Het
Vamp5	T	C	6: 72,370,198	D46G	possibly damaging	Het
Vmn1r23	T	A	6: 57,926,325	Q156L	probably benign	Het
Vmn2r6	C	T	3: 64,547,408	S490N	probably benign	Het
Vps39	A	T	2: 120,352,959	I10N	probably damaging	Het
Vwf	C	T	6: 125,645,934	Q1755*	probably null	Het
Wdfy4	A	T	14: 33,155,760	H82Q	probably benign	Het
Wdr24	T	C	17: 25,826,127	Y279H	probably damaging	Het
Wdr72	A	G	9: 74,210,561	T852A	probably benign	Het
Zfp1	T	A	8: 111,669,723	C92*	probably null	Het
Zfp426	A	T	9: 20,475,073		probably benign	Het
Zfp442	C	T	2: 150,411,210		probably null	Het
Zfp74	T	C	7: 29,936,045		probably benign	Het

Other mutations in Nfx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Nfx1	APN	4	40977241	missense	probably benign	0.00
IGL01998:Nfx1	APN	4	41004353	missense	probably damaging	1.00
IGL02072:Nfx1	APN	4	41016119	missense	probably benign
IGL02170:Nfx1	APN	4	41018019	missense	probably damaging	1.00
IGL02188:Nfx1	APN	4	40993827	missense	probably damaging	1.00
IGL02502:Nfx1	APN	4	40976345	splice site	probably benign
IGL02674:Nfx1	APN	4	40999717	critical splice donor site	probably null
IGL03007:Nfx1	APN	4	40984962	missense	probably benign	0.02
IGL03092:Nfx1	APN	4	41024851	missense	probably damaging	1.00
IGL03303:Nfx1	APN	4	41004323	splice site	probably benign
K7371:Nfx1	UTSW	4	40976803	missense	probably damaging	1.00
PIT4498001:Nfx1	UTSW	4	40977244	missense	probably benign
R0032:Nfx1	UTSW	4	41015321	missense	probably benign	0.00
R0032:Nfx1	UTSW	4	41015321	missense	probably benign	0.00
R0069:Nfx1	UTSW	4	40986688	splice site	probably benign
R1056:Nfx1	UTSW	4	41003057	missense	probably damaging	0.97
R1449:Nfx1	UTSW	4	40976803	missense	probably damaging	1.00
R1635:Nfx1	UTSW	4	40977004	missense	probably benign
R1636:Nfx1	UTSW	4	41016072	splice site	probably null
R1882:Nfx1	UTSW	4	41009240	missense	possibly damaging	0.55
R2089:Nfx1	UTSW	4	40977004	missense	probably benign
R2091:Nfx1	UTSW	4	40977004	missense	probably benign
R2091:Nfx1	UTSW	4	40977004	missense	probably benign
R3792:Nfx1	UTSW	4	41004357	nonsense	probably null
R3793:Nfx1	UTSW	4	41004357	nonsense	probably null
R4668:Nfx1	UTSW	4	40976367	missense	possibly damaging	0.50
R4678:Nfx1	UTSW	4	41012070	missense	probably benign	0.01
R4972:Nfx1	UTSW	4	40976375	missense	probably benign	0.36
R5066:Nfx1	UTSW	4	40991868	missense	probably benign
R5389:Nfx1	UTSW	4	40985000	missense	probably damaging	1.00
R5429:Nfx1	UTSW	4	41004343	missense	probably damaging	1.00
R5643:Nfx1	UTSW	4	40984973	missense	probably null	1.00
R5644:Nfx1	UTSW	4	40984973	missense	probably null	1.00
R5915:Nfx1	UTSW	4	40977285	missense	probably benign	0.02
R6286:Nfx1	UTSW	4	40986728	missense	probably damaging	1.00
R6393:Nfx1	UTSW	4	40976851	missense	possibly damaging	0.92
R7409:Nfx1	UTSW	4	41021830	missense	possibly damaging	0.64
R7523:Nfx1	UTSW	4	41016119	missense	probably benign
R7916:Nfx1	UTSW	4	40977142	missense	probably benign	0.11
R8497:Nfx1	UTSW	4	40976968	missense	possibly damaging	0.67
R8799:Nfx1	UTSW	4	41023727	missense	probably damaging	1.00
R9154:Nfx1	UTSW	4	40990845	missense	probably damaging	1.00
R9364:Nfx1	UTSW	4	41023756	missense	probably benign	0.31
R9497:Nfx1	UTSW	4	40994104	missense	probably benign	0.00
X0025:Nfx1	UTSW	4	40976422	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- AGCAGGCAACATGCTAGTGC -3'
(R):5'- CATGTGGCTAAATCACAGTAGTGC -3'

Sequencing Primer
(F):5'- GCAACATGCTAGTGCCCAGC -3'
(R):5'- AGTAGTGCTGTTTCTTTCTTCACATG -3'

Posted On

2016-03-17