Incidental Mutation 'R4894:Ipo13'
ID 377480
Institutional Source Beutler Lab
Gene Symbol Ipo13
Ensembl Gene ENSMUSG00000033365
Gene Name importin 13
Synonyms Imp13, Kap13
Accession Numbers
Essential gene? Probably essential (E-score: 0.959) question?
Stock # R4894 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 117751683-117772196 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 117760638 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 614 (I614S)
Ref Sequence ENSEMBL: ENSMUSP00000035989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036156]
AlphaFold Q8K0C1
Predicted Effect probably damaging
Transcript: ENSMUST00000036156
AA Change: I614S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035989
Gene: ENSMUSG00000033365
AA Change: I614S

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
IBN_N 45 111 2.05e-7 SMART
Pfam:Xpo1 116 263 4.8e-29 PFAM
low complexity region 668 692 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153918
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the importin-beta family of nuclear transport proteins. The encoded protein mediates the import of specific cargo proteins from the cytoplasm to the nucleus and is dependent on the Ras-related nuclear protein-GTPase system. The encoded protein is also involved in nuclear export of the eukaryotic translation initiation factor 1A.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion die prior to genotyping age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,609,975 (GRCm39) Y176* probably null Het
Akap13 T A 7: 75,375,068 (GRCm39) M1900K possibly damaging Het
Ankrd36 A G 11: 5,585,332 (GRCm39) E381G probably damaging Het
Ap3s1 T C 18: 46,891,183 (GRCm39) probably null Het
Cacna1e G T 1: 154,364,551 (GRCm39) S341* probably null Het
Camk1d G A 2: 5,359,539 (GRCm39) S161L probably damaging Het
Cdh23 G T 10: 60,173,630 (GRCm39) H1619Q probably benign Het
Chd7 T A 4: 8,838,629 (GRCm39) I1276N probably damaging Het
Clca3a1 A G 3: 144,719,662 (GRCm39) V436A probably damaging Het
Ctcfl G A 2: 172,959,196 (GRCm39) P177S probably benign Het
Dab2ip A G 2: 35,620,539 (GRCm39) probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Epc1 A T 18: 6,449,011 (GRCm39) S495R probably benign Het
Espl1 A G 15: 102,230,758 (GRCm39) probably null Het
Eya4 T C 10: 22,985,753 (GRCm39) E583G possibly damaging Het
Fam111a C G 19: 12,565,913 (GRCm39) T554R probably benign Het
Fbh1 A T 2: 11,767,771 (GRCm39) I359N probably damaging Het
Fer1l6 T C 15: 58,490,751 (GRCm39) C1023R probably damaging Het
Helz2 G C 2: 180,877,940 (GRCm39) P953A probably benign Het
Ifi204 G T 1: 173,587,808 (GRCm39) S117Y probably damaging Het
Ift70a1 T C 2: 75,810,088 (GRCm39) *665W probably null Het
Igfn1 G A 1: 135,882,520 (GRCm39) T2775M probably damaging Het
Igsf9 A G 1: 172,325,634 (GRCm39) T1101A probably benign Het
Kdm2b C A 5: 123,079,030 (GRCm39) E308* probably null Het
Klhl20 A T 1: 160,937,102 (GRCm39) M91K possibly damaging Het
Klrb1f T C 6: 129,030,151 (GRCm39) F64L probably benign Het
Ldlrad3 C T 2: 101,888,293 (GRCm39) C106Y probably damaging Het
Lilra6 T C 7: 3,915,530 (GRCm39) T161A probably benign Het
Lrriq1 A T 10: 102,997,613 (GRCm39) M1334K possibly damaging Het
Mepe C G 5: 104,473,268 (GRCm39) P3R probably damaging Het
Mgat4e A G 1: 134,468,856 (GRCm39) V396A probably benign Het
Nfx1 T G 4: 40,996,877 (GRCm39) S651A probably damaging Het
Or10ak13 A T 4: 118,639,483 (GRCm39) C100S probably damaging Het
Or2w6 T C 13: 21,843,352 (GRCm39) N47S probably damaging Het
Or4c109 T C 2: 88,817,783 (GRCm39) I254M possibly damaging Het
Rag2 T C 2: 101,460,022 (GRCm39) S111P probably damaging Het
Rai1 T A 11: 60,077,572 (GRCm39) D545E probably damaging Het
Ralgps1 A G 2: 33,033,115 (GRCm39) V498A possibly damaging Het
Rasal2 G A 1: 157,020,374 (GRCm39) S205L probably damaging Het
Rec8 T C 14: 55,862,787 (GRCm39) L582P probably damaging Het
Retn G A 8: 3,707,358 (GRCm39) R106H probably damaging Het
Rnf112 A G 11: 61,343,488 (GRCm39) L116P probably damaging Het
Rnf213 T C 11: 119,372,066 (GRCm39) Y4885H probably damaging Het
Sacm1l A G 9: 123,411,409 (GRCm39) I399M probably benign Het
Sez6 G T 11: 77,866,086 (GRCm39) G738V probably damaging Het
Spata17 A G 1: 186,872,643 (GRCm39) V56A probably benign Het
Spata31d1a A T 13: 59,849,542 (GRCm39) V862D probably damaging Het
Sptb A G 12: 76,671,768 (GRCm39) probably null Het
Srpk2 C A 5: 23,750,527 (GRCm39) G59W probably damaging Het
Tyro3 T C 2: 119,632,779 (GRCm39) S96P probably damaging Het
Ube2v1 A G 2: 167,452,280 (GRCm39) S108P probably damaging Het
Usp2 C T 9: 43,987,125 (GRCm39) S141L probably benign Het
Vamp5 T C 6: 72,347,181 (GRCm39) D46G possibly damaging Het
Vmn1r23 T A 6: 57,903,310 (GRCm39) Q156L probably benign Het
Vmn2r6 C T 3: 64,454,829 (GRCm39) S490N probably benign Het
Vps39 A T 2: 120,183,440 (GRCm39) I10N probably damaging Het
Vwf C T 6: 125,622,897 (GRCm39) Q1755* probably null Het
Wdfy4 A T 14: 32,877,717 (GRCm39) H82Q probably benign Het
Wdr24 T C 17: 26,045,101 (GRCm39) Y279H probably damaging Het
Wdr72 A G 9: 74,117,843 (GRCm39) T852A probably benign Het
Zfp1 T A 8: 112,396,355 (GRCm39) C92* probably null Het
Zfp1004 T A 2: 150,033,899 (GRCm39) C104* probably null Het
Zfp426 A T 9: 20,386,369 (GRCm39) probably benign Het
Zfp442 C T 2: 150,253,130 (GRCm39) probably null Het
Zfp74 T C 7: 29,635,470 (GRCm39) probably benign Het
Other mutations in Ipo13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ipo13 APN 4 117,760,602 (GRCm39) missense probably benign 0.10
IGL00800:Ipo13 APN 4 117,769,505 (GRCm39) missense probably benign 0.31
IGL00971:Ipo13 APN 4 117,771,564 (GRCm39) missense possibly damaging 0.83
IGL01552:Ipo13 APN 4 117,758,161 (GRCm39) missense probably benign 0.16
IGL01957:Ipo13 APN 4 117,761,078 (GRCm39) missense probably damaging 0.99
IGL02262:Ipo13 APN 4 117,761,010 (GRCm39) missense probably damaging 1.00
R0109:Ipo13 UTSW 4 117,762,213 (GRCm39) missense possibly damaging 0.92
R0142:Ipo13 UTSW 4 117,762,766 (GRCm39) missense probably damaging 1.00
R0771:Ipo13 UTSW 4 117,751,843 (GRCm39) missense possibly damaging 0.78
R1248:Ipo13 UTSW 4 117,758,228 (GRCm39) missense probably damaging 1.00
R1381:Ipo13 UTSW 4 117,761,592 (GRCm39) missense probably damaging 1.00
R1497:Ipo13 UTSW 4 117,761,856 (GRCm39) missense probably benign 0.04
R1614:Ipo13 UTSW 4 117,761,815 (GRCm39) missense probably benign 0.00
R1711:Ipo13 UTSW 4 117,761,719 (GRCm39) missense probably benign 0.38
R2037:Ipo13 UTSW 4 117,761,858 (GRCm39) nonsense probably null
R2200:Ipo13 UTSW 4 117,762,100 (GRCm39) critical splice donor site probably null
R3698:Ipo13 UTSW 4 117,757,890 (GRCm39) missense probably damaging 1.00
R3949:Ipo13 UTSW 4 117,758,239 (GRCm39) missense probably benign 0.10
R4687:Ipo13 UTSW 4 117,758,773 (GRCm39) missense probably benign 0.06
R4894:Ipo13 UTSW 4 117,761,687 (GRCm39) missense possibly damaging 0.84
R4956:Ipo13 UTSW 4 117,758,768 (GRCm39) missense probably benign 0.00
R5679:Ipo13 UTSW 4 117,752,029 (GRCm39) missense probably damaging 1.00
R5879:Ipo13 UTSW 4 117,760,400 (GRCm39) missense possibly damaging 0.67
R5921:Ipo13 UTSW 4 117,769,286 (GRCm39) missense probably benign 0.14
R6250:Ipo13 UTSW 4 117,769,351 (GRCm39) missense possibly damaging 0.93
R6875:Ipo13 UTSW 4 117,762,108 (GRCm39) missense possibly damaging 0.90
R7178:Ipo13 UTSW 4 117,761,081 (GRCm39) missense possibly damaging 0.83
R7412:Ipo13 UTSW 4 117,752,068 (GRCm39) missense probably benign
R7687:Ipo13 UTSW 4 117,769,088 (GRCm39) missense probably benign 0.01
R7774:Ipo13 UTSW 4 117,771,494 (GRCm39) missense probably benign 0.11
R8390:Ipo13 UTSW 4 117,769,534 (GRCm39) missense probably damaging 0.99
R8489:Ipo13 UTSW 4 117,758,219 (GRCm39) missense probably damaging 0.98
R8525:Ipo13 UTSW 4 117,762,126 (GRCm39) missense probably damaging 0.99
R9039:Ipo13 UTSW 4 117,758,185 (GRCm39) missense probably damaging 0.98
R9229:Ipo13 UTSW 4 117,758,801 (GRCm39) missense probably damaging 0.96
R9319:Ipo13 UTSW 4 117,769,585 (GRCm39) missense probably benign 0.00
R9760:Ipo13 UTSW 4 117,762,778 (GRCm39) missense probably benign 0.05
Z1088:Ipo13 UTSW 4 117,761,877 (GRCm39) missense probably benign 0.14
Z1176:Ipo13 UTSW 4 117,761,827 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGGAGAATCGAATCAAGCTCC -3'
(R):5'- TCAAGCTTTCTAGGGGTCCC -3'

Sequencing Primer
(F):5'- GGAGAATCGAATCAAGCTCCAGATC -3'
(R):5'- TTGGTGGGGATCGCTCACC -3'
Posted On 2016-03-17