Incidental Mutation 'R4894:Kdm2b'
ID 377484
Institutional Source Beutler Lab
Gene Symbol Kdm2b
Ensembl Gene ENSMUSG00000029475
Gene Name lysine (K)-specific demethylase 2B
Synonyms Cxxc2, Fbxl10, Jhdm1b
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4894 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 123008727-123127333 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 123079030 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 308 (E308*)
Ref Sequence ENSEMBL: ENSMUSP00000118488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046073] [ENSMUST00000086200] [ENSMUST00000118027] [ENSMUST00000121739] [ENSMUST00000127403] [ENSMUST00000145082] [ENSMUST00000156474]
AlphaFold Q6P1G2
Predicted Effect probably null
Transcript: ENSMUST00000046073
AA Change: E314*
SMART Domains Protein: ENSMUSP00000038229
Gene: ENSMUSG00000029475
AA Change: E314*

DomainStartEndE-ValueType
Blast:JmjC 23 101 4e-41 BLAST
JmjC 147 315 3.61e-41 SMART
low complexity region 380 401 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
PDB:2YU2|A 472 546 1e-17 PDB
Pfam:zf-CXXC 578 624 3e-17 PFAM
PHD 634 696 8.58e-4 SMART
low complexity region 792 823 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 990 1006 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
FBOX 1038 1078 1.69e-2 SMART
LRR 1121 1143 1.31e2 SMART
LRR 1145 1170 2.9e2 SMART
LRR 1185 1209 2.04e2 SMART
LRR 1210 1235 1.1e1 SMART
LRR 1265 1290 3.91e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000086200
AA Change: E308*
SMART Domains Protein: ENSMUSP00000083376
Gene: ENSMUSG00000029475
AA Change: E308*

DomainStartEndE-ValueType
Blast:JmjC 17 95 4e-41 BLAST
JmjC 141 309 3.61e-41 SMART
low complexity region 374 395 N/A INTRINSIC
low complexity region 400 418 N/A INTRINSIC
PDB:2YU2|A 466 540 1e-17 PDB
Pfam:zf-CXXC 572 618 2.1e-17 PFAM
PHD 628 690 8.58e-4 SMART
low complexity region 786 817 N/A INTRINSIC
low complexity region 897 907 N/A INTRINSIC
low complexity region 984 1000 N/A INTRINSIC
low complexity region 1012 1026 N/A INTRINSIC
FBOX 1032 1072 1.69e-2 SMART
LRR 1115 1137 1.31e2 SMART
LRR 1139 1164 2.9e2 SMART
LRR 1179 1203 2.04e2 SMART
LRR 1204 1229 1.1e1 SMART
LRR 1259 1284 3.91e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118027
AA Change: E314*
SMART Domains Protein: ENSMUSP00000114052
Gene: ENSMUSG00000029475
AA Change: E314*

DomainStartEndE-ValueType
Blast:JmjC 23 101 4e-41 BLAST
JmjC 147 315 3.61e-41 SMART
low complexity region 380 401 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
PDB:2YU2|A 472 546 9e-18 PDB
Pfam:zf-CXXC 578 624 2.1e-17 PFAM
PHD 634 696 8.58e-4 SMART
low complexity region 865 875 N/A INTRINSIC
low complexity region 952 968 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
FBOX 1000 1040 1.69e-2 SMART
LRR 1083 1105 1.31e2 SMART
LRR 1107 1132 2.9e2 SMART
LRR 1147 1171 2.04e2 SMART
LRR 1172 1197 1.1e1 SMART
LRR 1227 1252 3.91e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121739
AA Change: E259*
SMART Domains Protein: ENSMUSP00000114049
Gene: ENSMUSG00000029475
AA Change: E259*

DomainStartEndE-ValueType
Blast:JmjC 1 46 2e-19 BLAST
JmjC 92 260 3.61e-41 SMART
low complexity region 325 346 N/A INTRINSIC
low complexity region 351 369 N/A INTRINSIC
PDB:2YU2|A 417 491 1e-17 PDB
Pfam:zf-CXXC 523 569 5.4e-17 PFAM
PHD 579 641 8.58e-4 SMART
low complexity region 737 768 N/A INTRINSIC
low complexity region 848 858 N/A INTRINSIC
low complexity region 935 951 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
FBOX 983 1023 1.69e-2 SMART
LRR 1066 1088 1.31e2 SMART
LRR 1090 1115 2.9e2 SMART
LRR 1130 1154 2.04e2 SMART
LRR 1155 1180 1.1e1 SMART
LRR 1210 1235 3.91e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123479
Predicted Effect probably benign
Transcript: ENSMUST00000127403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143273
Predicted Effect probably null
Transcript: ENSMUST00000145082
AA Change: E114*
SMART Domains Protein: ENSMUSP00000114731
Gene: ENSMUSG00000029475
AA Change: E114*

DomainStartEndE-ValueType
JmjC 1 115 4.87e-15 SMART
Blast:JmjC 118 286 7e-65 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000156474
AA Change: E308*
SMART Domains Protein: ENSMUSP00000118488
Gene: ENSMUSG00000029475
AA Change: E308*

DomainStartEndE-ValueType
Blast:JmjC 17 95 3e-42 BLAST
JmjC 141 309 3.61e-41 SMART
low complexity region 374 395 N/A INTRINSIC
low complexity region 400 418 N/A INTRINSIC
PDB:2YU2|A 466 512 1e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138929
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a H3K36-specific histone demethylase, which contains an N-terminal jumonji C domain, a CxxC zinc finger domain, a plant homeodomain finger, an F-box, and eight leucine-rich repeats. Amongst its demonstrated functions, this protein plays roles in the suppression of premature cellular senescence, leukemia maintenance and development, maintenance of mouse embryonic stem cell pluripotency, and induced pluripotent stem cell generation. Mice homozygous for a targeted deletion of the zinc finger domain display embryonic lethality with development ceasing at approximately 7 to 8 days post coitum, demonstrating an essential role in early development. A pseudogene of this gene is found on chromosome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a targeted allele that does not express the long form protein exhibit exencephaly, fetal and postnatal lethality, coloboma, curly tail, oligozoospermia, increased apoptosis, and increased neuronal precursor proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,609,975 (GRCm39) Y176* probably null Het
Akap13 T A 7: 75,375,068 (GRCm39) M1900K possibly damaging Het
Ankrd36 A G 11: 5,585,332 (GRCm39) E381G probably damaging Het
Ap3s1 T C 18: 46,891,183 (GRCm39) probably null Het
Cacna1e G T 1: 154,364,551 (GRCm39) S341* probably null Het
Camk1d G A 2: 5,359,539 (GRCm39) S161L probably damaging Het
Cdh23 G T 10: 60,173,630 (GRCm39) H1619Q probably benign Het
Chd7 T A 4: 8,838,629 (GRCm39) I1276N probably damaging Het
Clca3a1 A G 3: 144,719,662 (GRCm39) V436A probably damaging Het
Ctcfl G A 2: 172,959,196 (GRCm39) P177S probably benign Het
Dab2ip A G 2: 35,620,539 (GRCm39) probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Epc1 A T 18: 6,449,011 (GRCm39) S495R probably benign Het
Espl1 A G 15: 102,230,758 (GRCm39) probably null Het
Eya4 T C 10: 22,985,753 (GRCm39) E583G possibly damaging Het
Fam111a C G 19: 12,565,913 (GRCm39) T554R probably benign Het
Fbh1 A T 2: 11,767,771 (GRCm39) I359N probably damaging Het
Fer1l6 T C 15: 58,490,751 (GRCm39) C1023R probably damaging Het
Helz2 G C 2: 180,877,940 (GRCm39) P953A probably benign Het
Ifi204 G T 1: 173,587,808 (GRCm39) S117Y probably damaging Het
Ift70a1 T C 2: 75,810,088 (GRCm39) *665W probably null Het
Igfn1 G A 1: 135,882,520 (GRCm39) T2775M probably damaging Het
Igsf9 A G 1: 172,325,634 (GRCm39) T1101A probably benign Het
Ipo13 A C 4: 117,760,638 (GRCm39) I614S probably damaging Het
Ipo13 A G 4: 117,761,687 (GRCm39) I476T possibly damaging Het
Klhl20 A T 1: 160,937,102 (GRCm39) M91K possibly damaging Het
Klrb1f T C 6: 129,030,151 (GRCm39) F64L probably benign Het
Ldlrad3 C T 2: 101,888,293 (GRCm39) C106Y probably damaging Het
Lilra6 T C 7: 3,915,530 (GRCm39) T161A probably benign Het
Lrriq1 A T 10: 102,997,613 (GRCm39) M1334K possibly damaging Het
Mepe C G 5: 104,473,268 (GRCm39) P3R probably damaging Het
Mgat4e A G 1: 134,468,856 (GRCm39) V396A probably benign Het
Nfx1 T G 4: 40,996,877 (GRCm39) S651A probably damaging Het
Or10ak13 A T 4: 118,639,483 (GRCm39) C100S probably damaging Het
Or2w6 T C 13: 21,843,352 (GRCm39) N47S probably damaging Het
Or4c109 T C 2: 88,817,783 (GRCm39) I254M possibly damaging Het
Rag2 T C 2: 101,460,022 (GRCm39) S111P probably damaging Het
Rai1 T A 11: 60,077,572 (GRCm39) D545E probably damaging Het
Ralgps1 A G 2: 33,033,115 (GRCm39) V498A possibly damaging Het
Rasal2 G A 1: 157,020,374 (GRCm39) S205L probably damaging Het
Rec8 T C 14: 55,862,787 (GRCm39) L582P probably damaging Het
Retn G A 8: 3,707,358 (GRCm39) R106H probably damaging Het
Rnf112 A G 11: 61,343,488 (GRCm39) L116P probably damaging Het
Rnf213 T C 11: 119,372,066 (GRCm39) Y4885H probably damaging Het
Sacm1l A G 9: 123,411,409 (GRCm39) I399M probably benign Het
Sez6 G T 11: 77,866,086 (GRCm39) G738V probably damaging Het
Spata17 A G 1: 186,872,643 (GRCm39) V56A probably benign Het
Spata31d1a A T 13: 59,849,542 (GRCm39) V862D probably damaging Het
Sptb A G 12: 76,671,768 (GRCm39) probably null Het
Srpk2 C A 5: 23,750,527 (GRCm39) G59W probably damaging Het
Tyro3 T C 2: 119,632,779 (GRCm39) S96P probably damaging Het
Ube2v1 A G 2: 167,452,280 (GRCm39) S108P probably damaging Het
Usp2 C T 9: 43,987,125 (GRCm39) S141L probably benign Het
Vamp5 T C 6: 72,347,181 (GRCm39) D46G possibly damaging Het
Vmn1r23 T A 6: 57,903,310 (GRCm39) Q156L probably benign Het
Vmn2r6 C T 3: 64,454,829 (GRCm39) S490N probably benign Het
Vps39 A T 2: 120,183,440 (GRCm39) I10N probably damaging Het
Vwf C T 6: 125,622,897 (GRCm39) Q1755* probably null Het
Wdfy4 A T 14: 32,877,717 (GRCm39) H82Q probably benign Het
Wdr24 T C 17: 26,045,101 (GRCm39) Y279H probably damaging Het
Wdr72 A G 9: 74,117,843 (GRCm39) T852A probably benign Het
Zfp1 T A 8: 112,396,355 (GRCm39) C92* probably null Het
Zfp1004 T A 2: 150,033,899 (GRCm39) C104* probably null Het
Zfp426 A T 9: 20,386,369 (GRCm39) probably benign Het
Zfp442 C T 2: 150,253,130 (GRCm39) probably null Het
Zfp74 T C 7: 29,635,470 (GRCm39) probably benign Het
Other mutations in Kdm2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Kdm2b APN 5 123,099,630 (GRCm39) missense probably damaging 1.00
IGL02061:Kdm2b APN 5 123,021,404 (GRCm39) missense probably damaging 1.00
IGL02142:Kdm2b APN 5 123,085,898 (GRCm39) missense probably damaging 0.99
IGL02143:Kdm2b APN 5 123,085,898 (GRCm39) missense probably damaging 0.99
IGL02147:Kdm2b APN 5 123,085,898 (GRCm39) missense probably damaging 0.99
IGL02294:Kdm2b APN 5 123,099,537 (GRCm39) missense probably damaging 1.00
IGL02309:Kdm2b APN 5 123,085,883 (GRCm39) missense probably damaging 0.99
IGL03039:Kdm2b APN 5 123,019,734 (GRCm39) missense probably benign 0.06
IGL03134:Kdm2b UTSW 5 123,070,737 (GRCm39) missense probably damaging 1.00
PIT4520001:Kdm2b UTSW 5 123,079,110 (GRCm39) missense probably damaging 1.00
R0008:Kdm2b UTSW 5 123,019,806 (GRCm39) missense probably benign 0.08
R0592:Kdm2b UTSW 5 123,099,197 (GRCm39) splice site probably benign
R0894:Kdm2b UTSW 5 123,122,523 (GRCm39) critical splice donor site probably null
R1078:Kdm2b UTSW 5 123,099,604 (GRCm39) missense possibly damaging 0.83
R1387:Kdm2b UTSW 5 123,018,331 (GRCm39) missense probably damaging 1.00
R1441:Kdm2b UTSW 5 123,070,943 (GRCm39) missense probably benign 0.25
R1550:Kdm2b UTSW 5 123,019,120 (GRCm39) missense probably damaging 1.00
R1795:Kdm2b UTSW 5 123,122,523 (GRCm39) critical splice donor site probably null
R2060:Kdm2b UTSW 5 123,021,428 (GRCm39) missense probably damaging 1.00
R2161:Kdm2b UTSW 5 123,018,762 (GRCm39) missense probably damaging 1.00
R2259:Kdm2b UTSW 5 123,020,479 (GRCm39) missense probably damaging 1.00
R3843:Kdm2b UTSW 5 123,072,856 (GRCm39) missense probably damaging 0.98
R3844:Kdm2b UTSW 5 123,072,856 (GRCm39) missense probably damaging 0.98
R3859:Kdm2b UTSW 5 123,018,290 (GRCm39) missense probably damaging 1.00
R4506:Kdm2b UTSW 5 123,026,688 (GRCm39) missense possibly damaging 0.58
R4680:Kdm2b UTSW 5 123,072,849 (GRCm39) missense probably damaging 0.99
R4786:Kdm2b UTSW 5 123,018,917 (GRCm39) critical splice acceptor site probably null
R5265:Kdm2b UTSW 5 123,016,651 (GRCm39) missense probably damaging 1.00
R5522:Kdm2b UTSW 5 123,087,225 (GRCm39) missense probably damaging 1.00
R5746:Kdm2b UTSW 5 123,017,427 (GRCm39) missense probably damaging 1.00
R5813:Kdm2b UTSW 5 123,009,931 (GRCm39) missense probably benign 0.37
R5920:Kdm2b UTSW 5 123,018,359 (GRCm39) missense probably damaging 1.00
R5961:Kdm2b UTSW 5 123,070,724 (GRCm39) missense probably benign 0.37
R6029:Kdm2b UTSW 5 123,017,650 (GRCm39) missense probably damaging 1.00
R6280:Kdm2b UTSW 5 123,016,687 (GRCm39) missense probably damaging 1.00
R6303:Kdm2b UTSW 5 123,019,807 (GRCm39) missense probably benign 0.34
R6304:Kdm2b UTSW 5 123,019,807 (GRCm39) missense probably benign 0.34
R6383:Kdm2b UTSW 5 123,072,841 (GRCm39) missense probably damaging 1.00
R6432:Kdm2b UTSW 5 123,018,254 (GRCm39) missense probably damaging 1.00
R6513:Kdm2b UTSW 5 123,018,302 (GRCm39) missense probably damaging 0.99
R6526:Kdm2b UTSW 5 123,099,532 (GRCm39) missense probably damaging 1.00
R7213:Kdm2b UTSW 5 123,059,532 (GRCm39) missense probably damaging 0.99
R7226:Kdm2b UTSW 5 123,059,512 (GRCm39) missense possibly damaging 0.60
R7292:Kdm2b UTSW 5 123,018,854 (GRCm39) missense probably damaging 0.98
R7893:Kdm2b UTSW 5 123,085,802 (GRCm39) missense probably benign 0.12
R8021:Kdm2b UTSW 5 123,070,982 (GRCm39) missense probably damaging 0.99
R8038:Kdm2b UTSW 5 123,098,958 (GRCm39) intron probably benign
R8162:Kdm2b UTSW 5 123,072,856 (GRCm39) missense probably damaging 0.98
R8397:Kdm2b UTSW 5 123,018,579 (GRCm39) missense probably benign 0.03
R8411:Kdm2b UTSW 5 123,018,239 (GRCm39) missense probably damaging 1.00
R8899:Kdm2b UTSW 5 123,125,851 (GRCm39) nonsense probably null
R8997:Kdm2b UTSW 5 123,018,236 (GRCm39) missense probably null 0.99
R9142:Kdm2b UTSW 5 123,127,112 (GRCm39) unclassified probably benign
R9192:Kdm2b UTSW 5 123,070,679 (GRCm39) missense probably benign 0.05
R9238:Kdm2b UTSW 5 123,009,889 (GRCm39) missense probably damaging 0.98
R9455:Kdm2b UTSW 5 123,099,537 (GRCm39) missense probably damaging 1.00
R9644:Kdm2b UTSW 5 123,120,842 (GRCm39) missense probably damaging 0.98
R9731:Kdm2b UTSW 5 123,125,823 (GRCm39) missense probably benign 0.03
Z1177:Kdm2b UTSW 5 123,018,860 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTGCCTACGCCTGAACTTG -3'
(R):5'- GCATCACATGTCCTTGCACATC -3'

Sequencing Primer
(F):5'- CTTGAACAGAAACTCCAGAGATTTGG -3'
(R):5'- ATGTCCTTGCACATCCGTGTC -3'
Posted On 2016-03-17