Mutagenetix > Incidental Mutations

Incidental Mutation 'R4894:Vwf'

377488

Institutional Source

Beutler Lab

Gene Symbol

Vwf

Ensembl Gene

ENSMUSG00000001930

Gene Name

Von Willebrand factor

Synonyms

6820430P06Rik, B130011O06Rik

Accession Numbers

Genbank: NM_011708; MGI: 98941

Is this an essential gene?

Probably non essential (E-score: 0.179) question?

Stock #

R4894 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

125546774-125686679 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 125645934 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 1755 (Q1755*)

Ref Sequence

ENSEMBL: ENSMUSP00000107873 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112254]

Predicted Effect

probably null
Transcript: ENSMUST00000001995
AA Change: Q1755*

SMART Domains

Protein: ENSMUSP00000001995
Gene: ENSMUSG00000001930
AA Change: Q1755*

Domain	Start	End	E-Value	Type
VWD	20	178	3.43e-35	SMART
C8	218	292	1.11e-21	SMART
Pfam:TIL	295	348	2.9e-14	PFAM
VWC	350	410	8.71e-1	SMART
VWD	377	540	2.93e-52	SMART
C8	577	649	3.82e-25	SMART
Pfam:TIL	652	707	5.7e-14	PFAM
EGF_like	787	822	4.37e1	SMART
VWC	829	898	3.29e-3	SMART
VWD	856	1012	5.15e-39	SMART
C8	1053	1127	1.01e-33	SMART
Pfam:TIL	1141	1196	3.6e-9	PFAM
VWA	1275	1458	1.81e-20	SMART
low complexity region	1461	1474	N/A	INTRINSIC
VWA	1496	1669	8.43e-39	SMART
VWA	1689	1872	2.83e-31	SMART
VWC	1879	1946	2.99e0	SMART
VWD	1938	2101	5.03e-42	SMART
C8	2132	2200	1.29e-13	SMART
Pfam:TIL	2203	2254	1.2e-7	PFAM
VWC	2257	2325	3.16e-16	SMART
low complexity region	2414	2425	N/A	INTRINSIC
VWC	2431	2494	2.61e-17	SMART
VWC	2510	2574	3.37e0	SMART
VWC	2582	2644	2.55e-11	SMART
CT	2727	2812	1.37e-31	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000112254
AA Change: Q1755*

SMART Domains

Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: Q1755*

Domain	Start	End	E-Value	Type
VWD	23	181	3.43e-35	SMART
C8	221	295	1.11e-21	SMART
Pfam:TIL	298	351	6.9e-15	PFAM
VWC	353	413	8.71e-1	SMART
VWD	380	543	2.93e-52	SMART
C8	580	652	3.82e-25	SMART
Pfam:TIL	655	710	4.1e-14	PFAM
EGF_like	790	825	4.37e1	SMART
VWC	832	901	3.29e-3	SMART
VWD	859	1015	5.15e-39	SMART
C8	1056	1130	1.01e-33	SMART
Pfam:TIL	1144	1199	1.3e-9	PFAM
VWA	1278	1461	1.81e-20	SMART
low complexity region	1464	1477	N/A	INTRINSIC
VWA	1499	1672	8.43e-39	SMART
VWA	1692	1875	2.83e-31	SMART
VWC	1882	1949	2.99e0	SMART
VWD	1941	2104	5.03e-42	SMART
C8	2135	2203	1.29e-13	SMART
Pfam:TIL	2206	2257	8.3e-8	PFAM
VWC	2260	2328	3.16e-16	SMART
low complexity region	2417	2428	N/A	INTRINSIC
VWC	2434	2497	2.61e-17	SMART
VWC	2513	2577	3.37e0	SMART
VWC	2585	2647	2.55e-11	SMART
CT	2730	2815	1.37e-31	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134073

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141521

Predicted Effect

probably benign
Transcript: ENSMUST00000147101

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]

Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf1	C	A	17: 43,299,084	Y176*	probably null	Het
Akap13	T	A	7: 75,725,320	M1900K	possibly damaging	Het
Ankrd36	A	G	11: 5,635,332	E381G	probably damaging	Het
Ap3s1	T	C	18: 46,758,116		probably null	Het
Cacna1e	G	T	1: 154,488,805	S341*	probably null	Het
Camk1d	G	A	2: 5,354,728	S161L	probably damaging	Het
Cdh23	G	T	10: 60,337,851	H1619Q	probably benign	Het
Chd7	T	A	4: 8,838,629	I1276N	probably damaging	Het
Clca1	A	G	3: 145,013,901	V436A	probably damaging	Het
Ctcfl	G	A	2: 173,117,403	P177S	probably benign	Het
Dab2ip	A	G	2: 35,730,527		probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Epc1	A	T	18: 6,449,011	S495R	probably benign	Het
Espl1	A	G	15: 102,322,323		probably null	Het
Eya4	T	C	10: 23,109,854	E583G	possibly damaging	Het
Fam111a	C	G	19: 12,588,549	T554R	probably benign	Het
Fbxo18	A	T	2: 11,762,960	I359N	probably damaging	Het
Fer1l6	T	C	15: 58,618,902	C1023R	probably damaging	Het
Gm14139	T	A	2: 150,191,979	C104*	probably null	Het
Helz2	G	C	2: 181,236,147	P953A	probably benign	Het
Ifi204	G	T	1: 173,760,242	S117Y	probably damaging	Het
Igfn1	G	A	1: 135,954,782	T2775M	probably damaging	Het
Igsf9	A	G	1: 172,498,067	T1101A	probably benign	Het
Ipo13	A	C	4: 117,903,441	I614S	probably damaging	Het
Ipo13	A	G	4: 117,904,490	I476T	possibly damaging	Het
Kdm2b	C	A	5: 122,940,967	E308*	probably null	Het
Klhl20	A	T	1: 161,109,532	M91K	possibly damaging	Het
Klrb1f	T	C	6: 129,053,188	F64L	probably benign	Het
Ldlrad3	C	T	2: 102,057,948	C106Y	probably damaging	Het
Lilra6	T	C	7: 3,912,531	T161A	probably benign	Het
Lrriq1	A	T	10: 103,161,752	M1334K	possibly damaging	Het
Mepe	C	G	5: 104,325,402	P3R	probably damaging	Het
Mgat4e	A	G	1: 134,541,118	V396A	probably benign	Het
Nfx1	T	G	4: 40,996,877	S651A	probably damaging	Het
Olfr1214	T	C	2: 88,987,439	I254M	possibly damaging	Het
Olfr1337	A	T	4: 118,782,286	C100S	probably damaging	Het
Olfr1361	T	C	13: 21,659,182	N47S	probably damaging	Het
Rag2	T	C	2: 101,629,677	S111P	probably damaging	Het
Rai1	T	A	11: 60,186,746	D545E	probably damaging	Het
Ralgps1	A	G	2: 33,143,103	V498A	possibly damaging	Het
Rasal2	G	A	1: 157,192,804	S205L	probably damaging	Het
Rec8	T	C	14: 55,625,330	L582P	probably damaging	Het
Retn	G	A	8: 3,657,358	R106H	probably damaging	Het
Rnf112	A	G	11: 61,452,662	L116P	probably damaging	Het
Rnf213	T	C	11: 119,481,240	Y4885H	probably damaging	Het
Sacm1l	A	G	9: 123,582,344	I399M	probably benign	Het
Sez6	G	T	11: 77,975,260	G738V	probably damaging	Het
Spata17	A	G	1: 187,140,446	V56A	probably benign	Het
Spata31d1a	A	T	13: 59,701,728	V862D	probably damaging	Het
Sptb	A	G	12: 76,624,994		probably null	Het
Srpk2	C	A	5: 23,545,529	G59W	probably damaging	Het
Ttc30a1	T	C	2: 75,979,744	*665W	probably null	Het
Tyro3	T	C	2: 119,802,298	S96P	probably damaging	Het
Ube2v1	A	G	2: 167,610,360	S108P	probably damaging	Het
Usp2	C	T	9: 44,075,828	S141L	probably benign	Het
Vamp5	T	C	6: 72,370,198	D46G	possibly damaging	Het
Vmn1r23	T	A	6: 57,926,325	Q156L	probably benign	Het
Vmn2r6	C	T	3: 64,547,408	S490N	probably benign	Het
Vps39	A	T	2: 120,352,959	I10N	probably damaging	Het
Wdfy4	A	T	14: 33,155,760	H82Q	probably benign	Het
Wdr24	T	C	17: 25,826,127	Y279H	probably damaging	Het
Wdr72	A	G	9: 74,210,561	T852A	probably benign	Het
Zfp1	T	A	8: 111,669,723	C92*	probably null	Het
Zfp426	A	T	9: 20,475,073		probably benign	Het
Zfp442	C	T	2: 150,411,210		probably null	Het
Zfp74	T	C	7: 29,936,045		probably benign	Het

Other mutations in Vwf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Vwf	APN	6	125658872	missense	unknown
IGL00561:Vwf	APN	6	125642721	missense	possibly damaging	0.88
IGL01104:Vwf	APN	6	125683556	missense	probably damaging	1.00
IGL01404:Vwf	APN	6	125677970	missense	probably damaging	1.00
IGL01539:Vwf	APN	6	125590262	missense	possibly damaging	0.85
IGL01550:Vwf	APN	6	125679289	missense	probably benign	0.00
IGL01563:Vwf	APN	6	125591165	missense	probably damaging	1.00
IGL01637:Vwf	APN	6	125645736	missense	probably damaging	1.00
IGL01720:Vwf	APN	6	125642835	missense	possibly damaging	0.69
IGL01834:Vwf	APN	6	125590170	splice site	probably benign
IGL02103:Vwf	APN	6	125646355	missense	probably damaging	1.00
IGL02120:Vwf	APN	6	125616034	missense	probably benign	0.26
IGL02174:Vwf	APN	6	125555395	missense	probably damaging	1.00
IGL02203:Vwf	APN	6	125642406	missense	probably damaging	1.00
IGL02420:Vwf	APN	6	125677916	missense	probably benign	0.00
IGL02723:Vwf	APN	6	125642930	missense	possibly damaging	0.85
IGL02818:Vwf	APN	6	125663548	missense	probably benign
IGL02931:Vwf	APN	6	125615968	missense	possibly damaging	0.68
IGL03015:Vwf	APN	6	125684138	splice site	probably benign
IGL03038:Vwf	APN	6	125604157	missense	possibly damaging	0.92
IGL03060:Vwf	APN	6	125663560	missense	probably damaging	1.00
IGL03114:Vwf	APN	6	125599363	nonsense	probably null
IGL03266:Vwf	APN	6	125678077	splice site	probably benign
gingerman	UTSW	6	125662963	critical splice acceptor site	probably null
R0605_vwf_644	UTSW	6	125685837	missense	probably benign	0.02
R1575_Vwf_091	UTSW	6	125663571	nonsense	probably null
R1628_Vwf_608	UTSW	6	125647738	unclassified	probably benign
R1669_Vwf_448	UTSW	6	125647906	missense	possibly damaging	0.92
R1833_Vwf_948	UTSW	6	125642037	missense	probably benign	0.14
R2130_vwf_946	UTSW	6	125657057	missense	probably damaging	1.00
R6360_Vwf_065	UTSW	6	125683526	missense	probably benign	0.13
R7900_Vwf_938	UTSW	6	125628476	critical splice donor site	probably null
Russiahouse	UTSW	6	125639341	nonsense	probably null
B5639:Vwf	UTSW	6	125642984	missense	probably damaging	1.00
R0025:Vwf	UTSW	6	125682812	missense	probably benign	0.05
R0025:Vwf	UTSW	6	125682812	missense	probably benign	0.05
R0087:Vwf	UTSW	6	125645954	missense	probably benign	0.03
R0194:Vwf	UTSW	6	125643297	missense	probably benign
R0206:Vwf	UTSW	6	125637456	missense	probably damaging	1.00
R0233:Vwf	UTSW	6	125686510	missense	possibly damaging	0.91
R0233:Vwf	UTSW	6	125686510	missense	possibly damaging	0.91
R0390:Vwf	UTSW	6	125626361	nonsense	probably null
R0427:Vwf	UTSW	6	125673939	missense	probably benign
R0437:Vwf	UTSW	6	125566318	missense	probably damaging	1.00
R0470:Vwf	UTSW	6	125628428	missense	possibly damaging	0.70
R0499:Vwf	UTSW	6	125638114	missense	probably benign	0.10
R0554:Vwf	UTSW	6	125642781	missense	probably benign	0.13
R0605:Vwf	UTSW	6	125685837	missense	probably benign	0.02
R0711:Vwf	UTSW	6	125626271	missense	probably benign	0.01
R0723:Vwf	UTSW	6	125566262	missense	probably benign	0.01
R0973:Vwf	UTSW	6	125643006	missense	probably damaging	1.00
R1054:Vwf	UTSW	6	125590227	missense	probably damaging	1.00
R1115:Vwf	UTSW	6	125655065	missense	unknown
R1156:Vwf	UTSW	6	125637488	missense	probably damaging	1.00
R1191:Vwf	UTSW	6	125599252	missense	probably damaging	1.00
R1240:Vwf	UTSW	6	125603308	splice site	probably null
R1398:Vwf	UTSW	6	125603457	missense	probably benign	0.02
R1435:Vwf	UTSW	6	125642249	nonsense	probably null
R1528:Vwf	UTSW	6	125608291	missense	possibly damaging	0.69
R1575:Vwf	UTSW	6	125655251	missense	unknown
R1575:Vwf	UTSW	6	125663571	nonsense	probably null
R1628:Vwf	UTSW	6	125647738	unclassified	probably benign
R1669:Vwf	UTSW	6	125647906	missense	possibly damaging	0.92
R1699:Vwf	UTSW	6	125643069	missense	probably damaging	1.00
R1699:Vwf	UTSW	6	125685900	missense	possibly damaging	0.74
R1725:Vwf	UTSW	6	125646282	missense	probably benign	0.05
R1742:Vwf	UTSW	6	125667550	missense	probably benign	0.02
R1809:Vwf	UTSW	6	125590175	splice site	probably benign
R1833:Vwf	UTSW	6	125642037	missense	probably benign	0.14
R1866:Vwf	UTSW	6	125667529	missense	possibly damaging	0.62
R1870:Vwf	UTSW	6	125642939	missense	probably damaging	1.00
R1874:Vwf	UTSW	6	125628372	missense	probably benign	0.00
R1941:Vwf	UTSW	6	125639279	missense	possibly damaging	0.64
R2061:Vwf	UTSW	6	125591188	missense	probably damaging	0.98
R2103:Vwf	UTSW	6	125646330	missense	probably benign	0.31
R2104:Vwf	UTSW	6	125646330	missense	probably benign	0.31
R2130:Vwf	UTSW	6	125657057	missense	probably damaging	1.00
R2159:Vwf	UTSW	6	125626341	missense	probably damaging	0.99
R2178:Vwf	UTSW	6	125642132	missense	possibly damaging	0.90
R2656:Vwf	UTSW	6	125555361	missense	probably benign	0.00
R2913:Vwf	UTSW	6	125685846	missense	probably benign	0.08
R2917:Vwf	UTSW	6	125608143	missense	probably benign	0.07
R3726:Vwf	UTSW	6	125677948	utr 3 prime	probably benign
R3735:Vwf	UTSW	6	125588613	missense	probably damaging	1.00
R3774:Vwf	UTSW	6	125649099	splice site	probably null
R3934:Vwf	UTSW	6	125555499	missense	probably damaging	1.00
R4291:Vwf	UTSW	6	125642322	missense	probably damaging	1.00
R4384:Vwf	UTSW	6	125655116	missense	unknown
R4743:Vwf	UTSW	6	125684091	critical splice acceptor site	probably null
R4760:Vwf	UTSW	6	125570604	missense	probably damaging	1.00
R4776:Vwf	UTSW	6	125566305	missense	possibly damaging	0.53
R4791:Vwf	UTSW	6	125643363	missense
R4871:Vwf	UTSW	6	125686462	missense	probably benign	0.25
R4963:Vwf	UTSW	6	125667483	nonsense	probably null
R5010:Vwf	UTSW	6	125566257	missense	probably benign	0.15
R5289:Vwf	UTSW	6	125667510	utr 3 prime	probably benign
R5512:Vwf	UTSW	6	125673887	utr 3 prime	probably benign
R5523:Vwf	UTSW	6	125643042	missense
R5642:Vwf	UTSW	6	125603418	missense
R5860:Vwf	UTSW	6	125643090	missense
R5860:Vwf	UTSW	6	125679265	utr 3 prime	probably benign
R5896:Vwf	UTSW	6	125678762	critical splice acceptor site	probably null
R5926:Vwf	UTSW	6	125604174	missense	probably damaging	1.00
R5976:Vwf	UTSW	6	125603463	missense
R6053:Vwf	UTSW	6	125600665	missense	probably benign	0.21
R6151:Vwf	UTSW	6	125657065	missense	unknown
R6179:Vwf	UTSW	6	125649289	missense	unknown
R6181:Vwf	UTSW	6	125566146	missense	probably damaging	0.98
R6234:Vwf	UTSW	6	125657165	missense	unknown
R6360:Vwf	UTSW	6	125683526	missense	probably benign	0.13
R6412:Vwf	UTSW	6	125679316	missense	probably benign	0.00
R6464:Vwf	UTSW	6	125639400	critical splice donor site	probably null
R6522:Vwf	UTSW	6	125662963	critical splice acceptor site	probably null
R6766:Vwf	UTSW	6	125639376	missense	unknown
R6856:Vwf	UTSW	6	125642150	nonsense	probably null
R6877:Vwf	UTSW	6	125657201	missense	possibly damaging	0.48
R6896:Vwf	UTSW	6	125566194	missense	probably damaging	1.00
R7113:Vwf	UTSW	6	125655044	missense
R7287:Vwf	UTSW	6	125637467	missense
R7359:Vwf	UTSW	6	125566257	missense
R7509:Vwf	UTSW	6	125642169	missense
R7519:Vwf	UTSW	6	125667543	missense
R7545:Vwf	UTSW	6	125614097	missense
R7549:Vwf	UTSW	6	125626267	missense
R7593:Vwf	UTSW	6	125647768	missense
R7635:Vwf	UTSW	6	125682734	missense
R7793:Vwf	UTSW	6	125686520	missense
R7802:Vwf	UTSW	6	125666677	missense
R7824:Vwf	UTSW	6	125658815	missense
R7849:Vwf	UTSW	6	125656803	missense
R7900:Vwf	UTSW	6	125628476	critical splice donor site	probably null
R7919:Vwf	UTSW	6	125647859	missense
R7966:Vwf	UTSW	6	125639341	nonsense	probably null
R8101:Vwf	UTSW	6	125570559	nonsense	probably null
R8162:Vwf	UTSW	6	125645836	splice site	probably null
R8345:Vwf	UTSW	6	125679302	missense
R8853:Vwf	UTSW	6	125657264	missense
X0021:Vwf	UTSW	6	125646331	missense	probably damaging	1.00
X0065:Vwf	UTSW	6	125603433	missense	probably null	0.05
Z1176:Vwf	UTSW	6	125591231	missense
Z1176:Vwf	UTSW	6	125603308	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TGATACCCTTGAACCTGCAG -3'
(R):5'- TCAGAACAATACTTGGTGGGACTG -3'

Sequencing Primer
(F):5'- CCTGCAGGTGAGGGAGTG -3'
(R):5'- AAGGACCATCTAGCTTCTCGC -3'

Posted On

2016-03-17