Incidental Mutation 'R4894:Zfp1'
ID377497
Institutional Source Beutler Lab
Gene Symbol Zfp1
Ensembl Gene ENSMUSG00000055835
Gene Namezinc finger protein 1
SynonymsFnp-1, mkr-1, Zfp-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R4894 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location111643401-111671011 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 111669723 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 92 (C92*)
Ref Sequence ENSEMBL: ENSMUSP00000148511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077791] [ENSMUST00000211926] [ENSMUST00000212072] [ENSMUST00000212206]
Predicted Effect probably null
Transcript: ENSMUST00000077791
AA Change: C125*
SMART Domains Protein: ENSMUSP00000076964
Gene: ENSMUSG00000055835
AA Change: C125*

DomainStartEndE-ValueType
KRAB 8 71 8.91e-21 SMART
ZnF_C2H2 183 205 5.14e-3 SMART
ZnF_C2H2 211 233 9.22e-5 SMART
ZnF_C2H2 239 261 1.72e-4 SMART
ZnF_C2H2 267 289 5.59e-4 SMART
ZnF_C2H2 295 317 3.16e-3 SMART
ZnF_C2H2 323 345 5.21e-4 SMART
ZnF_C2H2 351 373 2.65e-5 SMART
ZnF_C2H2 379 401 8.47e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000211926
AA Change: C111*
Predicted Effect probably null
Transcript: ENSMUST00000212072
AA Change: C92*
Predicted Effect probably benign
Transcript: ENSMUST00000212206
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the zinc finger protein family. Some members of this family bind to DNA by zinc-mediated secondary structures called zinc fingers, and are involved in transcriptional regulation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,299,084 Y176* probably null Het
Akap13 T A 7: 75,725,320 M1900K possibly damaging Het
Ankrd36 A G 11: 5,635,332 E381G probably damaging Het
Ap3s1 T C 18: 46,758,116 probably null Het
Cacna1e G T 1: 154,488,805 S341* probably null Het
Camk1d G A 2: 5,354,728 S161L probably damaging Het
Cdh23 G T 10: 60,337,851 H1619Q probably benign Het
Chd7 T A 4: 8,838,629 I1276N probably damaging Het
Clca1 A G 3: 145,013,901 V436A probably damaging Het
Ctcfl G A 2: 173,117,403 P177S probably benign Het
Dab2ip A G 2: 35,730,527 probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epc1 A T 18: 6,449,011 S495R probably benign Het
Espl1 A G 15: 102,322,323 probably null Het
Eya4 T C 10: 23,109,854 E583G possibly damaging Het
Fam111a C G 19: 12,588,549 T554R probably benign Het
Fbxo18 A T 2: 11,762,960 I359N probably damaging Het
Fer1l6 T C 15: 58,618,902 C1023R probably damaging Het
Gm14139 T A 2: 150,191,979 C104* probably null Het
Helz2 G C 2: 181,236,147 P953A probably benign Het
Ifi204 G T 1: 173,760,242 S117Y probably damaging Het
Igfn1 G A 1: 135,954,782 T2775M probably damaging Het
Igsf9 A G 1: 172,498,067 T1101A probably benign Het
Ipo13 A C 4: 117,903,441 I614S probably damaging Het
Ipo13 A G 4: 117,904,490 I476T possibly damaging Het
Kdm2b C A 5: 122,940,967 E308* probably null Het
Klhl20 A T 1: 161,109,532 M91K possibly damaging Het
Klrb1f T C 6: 129,053,188 F64L probably benign Het
Ldlrad3 C T 2: 102,057,948 C106Y probably damaging Het
Lilra6 T C 7: 3,912,531 T161A probably benign Het
Lrriq1 A T 10: 103,161,752 M1334K possibly damaging Het
Mepe C G 5: 104,325,402 P3R probably damaging Het
Mgat4e A G 1: 134,541,118 V396A probably benign Het
Nfx1 T G 4: 40,996,877 S651A probably damaging Het
Olfr1214 T C 2: 88,987,439 I254M possibly damaging Het
Olfr1337 A T 4: 118,782,286 C100S probably damaging Het
Olfr1361 T C 13: 21,659,182 N47S probably damaging Het
Rag2 T C 2: 101,629,677 S111P probably damaging Het
Rai1 T A 11: 60,186,746 D545E probably damaging Het
Ralgps1 A G 2: 33,143,103 V498A possibly damaging Het
Rasal2 G A 1: 157,192,804 S205L probably damaging Het
Rec8 T C 14: 55,625,330 L582P probably damaging Het
Retn G A 8: 3,657,358 R106H probably damaging Het
Rnf112 A G 11: 61,452,662 L116P probably damaging Het
Rnf213 T C 11: 119,481,240 Y4885H probably damaging Het
Sacm1l A G 9: 123,582,344 I399M probably benign Het
Sez6 G T 11: 77,975,260 G738V probably damaging Het
Spata17 A G 1: 187,140,446 V56A probably benign Het
Spata31d1a A T 13: 59,701,728 V862D probably damaging Het
Sptb A G 12: 76,624,994 probably null Het
Srpk2 C A 5: 23,545,529 G59W probably damaging Het
Ttc30a1 T C 2: 75,979,744 *665W probably null Het
Tyro3 T C 2: 119,802,298 S96P probably damaging Het
Ube2v1 A G 2: 167,610,360 S108P probably damaging Het
Usp2 C T 9: 44,075,828 S141L probably benign Het
Vamp5 T C 6: 72,370,198 D46G possibly damaging Het
Vmn1r23 T A 6: 57,926,325 Q156L probably benign Het
Vmn2r6 C T 3: 64,547,408 S490N probably benign Het
Vps39 A T 2: 120,352,959 I10N probably damaging Het
Vwf C T 6: 125,645,934 Q1755* probably null Het
Wdfy4 A T 14: 33,155,760 H82Q probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Wdr72 A G 9: 74,210,561 T852A probably benign Het
Zfp426 A T 9: 20,475,073 probably benign Het
Zfp442 C T 2: 150,411,210 probably null Het
Zfp74 T C 7: 29,936,045 probably benign Het
Other mutations in Zfp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00732:Zfp1 APN 8 111670418 missense probably damaging 1.00
R0402:Zfp1 UTSW 8 111670243 missense probably damaging 0.98
R4381:Zfp1 UTSW 8 111670451 missense probably damaging 1.00
R4478:Zfp1 UTSW 8 111670543 missense probably damaging 1.00
R6067:Zfp1 UTSW 8 111670343 missense probably damaging 1.00
R6078:Zfp1 UTSW 8 111670343 missense probably damaging 1.00
R6723:Zfp1 UTSW 8 111670339 missense probably damaging 1.00
R7711:Zfp1 UTSW 8 111670162 missense not run
U15987:Zfp1 UTSW 8 111670343 missense probably damaging 1.00
X0026:Zfp1 UTSW 8 111670112 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGGGGTCACTTACAACCATC -3'
(R):5'- TAACGAGCAGCGACTTGAAG -3'

Sequencing Primer
(F):5'- GGGGTCACTTACAACCATCAAGAAC -3'
(R):5'- GGTCTTGTCACAGTAGTTACAGAC -3'
Posted On2016-03-17