Incidental Mutation 'R4894:Usp2'
ID377498
Institutional Source Beutler Lab
Gene Symbol Usp2
Ensembl Gene ENSMUSG00000032010
Gene Nameubiquitin specific peptidase 2
Synonymsubp41, B930035K21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4894 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44067021-44095627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44075828 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 141 (S141L)
Ref Sequence ENSEMBL: ENSMUSP00000135859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034508] [ENSMUST00000114830] [ENSMUST00000162126] [ENSMUST00000176671] [ENSMUST00000177054] [ENSMUST00000185479]
Predicted Effect probably benign
Transcript: ENSMUST00000034508
AA Change: S141L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000034508
Gene: ENSMUSG00000032010
AA Change: S141L

DomainStartEndE-ValueType
low complexity region 103 116 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
Pfam:UCH 280 610 8.4e-75 PFAM
Pfam:UCH_1 281 592 3.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114830
AA Change: S141L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000110479
Gene: ENSMUSG00000032010
AA Change: S141L

DomainStartEndE-ValueType
low complexity region 103 116 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
Pfam:UCH 280 610 2.9e-78 PFAM
Pfam:UCH_1 281 592 7.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162126
SMART Domains Protein: ENSMUSP00000123938
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176671
AA Change: S141L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000135859
Gene: ENSMUSG00000032010
AA Change: S141L

DomainStartEndE-ValueType
low complexity region 103 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177054
AA Change: S141L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000135018
Gene: ENSMUSG00000032010
AA Change: S141L

DomainStartEndE-ValueType
low complexity region 103 116 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
Pfam:UCH 280 610 2.9e-78 PFAM
Pfam:UCH_1 281 592 7.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185479
SMART Domains Protein: ENSMUSP00000140405
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216448
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of de-ubiquitinating enzymes, which belongs to the peptidase C19 superfamily. The encoded protein is a ubiquitin-specific protease which is required for TNF-alpha (tumor necrosis factor alpha) -induced NF-kB (nuclear factor kB) signaling. This protein deubiquitinates polyubiquitinated target proteins such as fatty acid synthase, murine double minute 2 (MDM2), MDM4/MDMX and cyclin D1. MDM2 and MDM4 are negative regulators of the p53 tumor suppressor and cyclin D1 is required for cell cycle G1/S transition. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null mutation display severely reduced male fertility with defects in sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,299,084 Y176* probably null Het
Akap13 T A 7: 75,725,320 M1900K possibly damaging Het
Ankrd36 A G 11: 5,635,332 E381G probably damaging Het
Ap3s1 T C 18: 46,758,116 probably null Het
Cacna1e G T 1: 154,488,805 S341* probably null Het
Camk1d G A 2: 5,354,728 S161L probably damaging Het
Cdh23 G T 10: 60,337,851 H1619Q probably benign Het
Chd7 T A 4: 8,838,629 I1276N probably damaging Het
Clca1 A G 3: 145,013,901 V436A probably damaging Het
Ctcfl G A 2: 173,117,403 P177S probably benign Het
Dab2ip A G 2: 35,730,527 probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epc1 A T 18: 6,449,011 S495R probably benign Het
Espl1 A G 15: 102,322,323 probably null Het
Eya4 T C 10: 23,109,854 E583G possibly damaging Het
Fam111a C G 19: 12,588,549 T554R probably benign Het
Fbxo18 A T 2: 11,762,960 I359N probably damaging Het
Fer1l6 T C 15: 58,618,902 C1023R probably damaging Het
Gm14139 T A 2: 150,191,979 C104* probably null Het
Helz2 G C 2: 181,236,147 P953A probably benign Het
Ifi204 G T 1: 173,760,242 S117Y probably damaging Het
Igfn1 G A 1: 135,954,782 T2775M probably damaging Het
Igsf9 A G 1: 172,498,067 T1101A probably benign Het
Ipo13 A C 4: 117,903,441 I614S probably damaging Het
Ipo13 A G 4: 117,904,490 I476T possibly damaging Het
Kdm2b C A 5: 122,940,967 E308* probably null Het
Klhl20 A T 1: 161,109,532 M91K possibly damaging Het
Klrb1f T C 6: 129,053,188 F64L probably benign Het
Ldlrad3 C T 2: 102,057,948 C106Y probably damaging Het
Lilra6 T C 7: 3,912,531 T161A probably benign Het
Lrriq1 A T 10: 103,161,752 M1334K possibly damaging Het
Mepe C G 5: 104,325,402 P3R probably damaging Het
Mgat4e A G 1: 134,541,118 V396A probably benign Het
Nfx1 T G 4: 40,996,877 S651A probably damaging Het
Olfr1214 T C 2: 88,987,439 I254M possibly damaging Het
Olfr1337 A T 4: 118,782,286 C100S probably damaging Het
Olfr1361 T C 13: 21,659,182 N47S probably damaging Het
Rag2 T C 2: 101,629,677 S111P probably damaging Het
Rai1 T A 11: 60,186,746 D545E probably damaging Het
Ralgps1 A G 2: 33,143,103 V498A possibly damaging Het
Rasal2 G A 1: 157,192,804 S205L probably damaging Het
Rec8 T C 14: 55,625,330 L582P probably damaging Het
Retn G A 8: 3,657,358 R106H probably damaging Het
Rnf112 A G 11: 61,452,662 L116P probably damaging Het
Rnf213 T C 11: 119,481,240 Y4885H probably damaging Het
Sacm1l A G 9: 123,582,344 I399M probably benign Het
Sez6 G T 11: 77,975,260 G738V probably damaging Het
Spata17 A G 1: 187,140,446 V56A probably benign Het
Spata31d1a A T 13: 59,701,728 V862D probably damaging Het
Sptb A G 12: 76,624,994 probably null Het
Srpk2 C A 5: 23,545,529 G59W probably damaging Het
Ttc30a1 T C 2: 75,979,744 *665W probably null Het
Tyro3 T C 2: 119,802,298 S96P probably damaging Het
Ube2v1 A G 2: 167,610,360 S108P probably damaging Het
Vamp5 T C 6: 72,370,198 D46G possibly damaging Het
Vmn1r23 T A 6: 57,926,325 Q156L probably benign Het
Vmn2r6 C T 3: 64,547,408 S490N probably benign Het
Vps39 A T 2: 120,352,959 I10N probably damaging Het
Vwf C T 6: 125,645,934 Q1755* probably null Het
Wdfy4 A T 14: 33,155,760 H82Q probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Wdr72 A G 9: 74,210,561 T852A probably benign Het
Zfp1 T A 8: 111,669,723 C92* probably null Het
Zfp426 A T 9: 20,475,073 probably benign Het
Zfp442 C T 2: 150,411,210 probably null Het
Zfp74 T C 7: 29,936,045 probably benign Het
Other mutations in Usp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Usp2 APN 9 44089165 nonsense probably null
IGL01574:Usp2 APN 9 44093803 missense probably damaging 1.00
IGL02103:Usp2 APN 9 44089128 intron probably benign
IGL02391:Usp2 APN 9 44091227 missense probably damaging 1.00
R0385:Usp2 UTSW 9 44092750 missense probably damaging 0.99
R0555:Usp2 UTSW 9 44092784 missense probably damaging 1.00
R0614:Usp2 UTSW 9 44092492 nonsense probably null
R1553:Usp2 UTSW 9 44092155 missense probably damaging 0.99
R1851:Usp2 UTSW 9 44075966 missense probably benign 0.00
R2437:Usp2 UTSW 9 44092148 missense probably damaging 0.98
R3962:Usp2 UTSW 9 44075657 missense possibly damaging 0.82
R4392:Usp2 UTSW 9 44091259 missense probably damaging 1.00
R4411:Usp2 UTSW 9 44091063 missense probably damaging 1.00
R4960:Usp2 UTSW 9 44075813 missense probably damaging 1.00
R5482:Usp2 UTSW 9 44089183 critical splice donor site probably null
R5496:Usp2 UTSW 9 44085208 missense possibly damaging 0.95
R5932:Usp2 UTSW 9 44092333 missense probably benign
R6956:Usp2 UTSW 9 44092756 missense probably damaging 1.00
R7007:Usp2 UTSW 9 44090042 missense probably damaging 1.00
R7224:Usp2 UTSW 9 44075969 missense possibly damaging 0.95
R7635:Usp2 UTSW 9 44067222 critical splice donor site probably null
R7707:Usp2 UTSW 9 44073460 splice site probably null
RF007:Usp2 UTSW 9 44089121 critical splice acceptor site probably benign
RF012:Usp2 UTSW 9 44089130 critical splice acceptor site probably benign
RF015:Usp2 UTSW 9 44089109 critical splice acceptor site probably benign
RF036:Usp2 UTSW 9 44089124 critical splice acceptor site probably benign
RF046:Usp2 UTSW 9 44089111 critical splice acceptor site probably benign
RF051:Usp2 UTSW 9 44089129 critical splice acceptor site probably benign
RF053:Usp2 UTSW 9 44089129 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- ATCATTGGGAGTAGTAAGCGGTC -3'
(R):5'- CACTGCCCTTTCGACCATAG -3'

Sequencing Primer
(F):5'- TCAGAGAGCCAGACCCGTG -3'
(R):5'- CTGTTAGGTACTCAGAACGGC -3'
Posted On2016-03-17