Incidental Mutation 'R4894:Eya4'
ID377502
Institutional Source Beutler Lab
Gene Symbol Eya4
Ensembl Gene ENSMUSG00000010461
Gene NameEYA transcriptional coactivator and phosphatase 4
SynonymsB130023L16Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4894 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location23102963-23350786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23109854 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 583 (E583G)
Ref Sequence ENSEMBL: ENSMUSP00000090335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074366] [ENSMUST00000092665] [ENSMUST00000219315] [ENSMUST00000220299]
Predicted Effect probably benign
Transcript: ENSMUST00000074366
SMART Domains Protein: ENSMUSP00000073970
Gene: ENSMUSG00000010461

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-163 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000092665
AA Change: E583G

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090335
Gene: ENSMUSG00000010461
AA Change: E583G

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-172 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218867
Predicted Effect probably benign
Transcript: ENSMUST00000219315
AA Change: E606G

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000220299
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator through its protein phosphatase activity, and it may be important for eye development, and for continued function of the mature organ of Corti. Mutations in this gene are associated with postlingual, progressive, autosomal dominant hearing loss at the deafness, autosomal dominant non-syndromic sensorineural 10 locus. The encoded protein is also a putative oncogene that mediates DNA repair, apoptosis, and innate immunity following DNA damage, cellular damage, and viral attack. Defects in this gene are also associated with dilated cardiomyopathy 1J. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice show strain background-dependent postnatal lethality, reduced body weight, male sterility, a delay in palate bone fusion, developmental defects in the eustachian tube and middle ear cavity, early-onset hearing deficits, and profound susceptibility to otitis media with effusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,299,084 Y176* probably null Het
Akap13 T A 7: 75,725,320 M1900K possibly damaging Het
Ankrd36 A G 11: 5,635,332 E381G probably damaging Het
Ap3s1 T C 18: 46,758,116 probably null Het
Cacna1e G T 1: 154,488,805 S341* probably null Het
Camk1d G A 2: 5,354,728 S161L probably damaging Het
Cdh23 G T 10: 60,337,851 H1619Q probably benign Het
Chd7 T A 4: 8,838,629 I1276N probably damaging Het
Clca1 A G 3: 145,013,901 V436A probably damaging Het
Ctcfl G A 2: 173,117,403 P177S probably benign Het
Dab2ip A G 2: 35,730,527 probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epc1 A T 18: 6,449,011 S495R probably benign Het
Espl1 A G 15: 102,322,323 probably null Het
Fam111a C G 19: 12,588,549 T554R probably benign Het
Fbxo18 A T 2: 11,762,960 I359N probably damaging Het
Fer1l6 T C 15: 58,618,902 C1023R probably damaging Het
Gm14139 T A 2: 150,191,979 C104* probably null Het
Helz2 G C 2: 181,236,147 P953A probably benign Het
Ifi204 G T 1: 173,760,242 S117Y probably damaging Het
Igfn1 G A 1: 135,954,782 T2775M probably damaging Het
Igsf9 A G 1: 172,498,067 T1101A probably benign Het
Ipo13 A C 4: 117,903,441 I614S probably damaging Het
Ipo13 A G 4: 117,904,490 I476T possibly damaging Het
Kdm2b C A 5: 122,940,967 E308* probably null Het
Klhl20 A T 1: 161,109,532 M91K possibly damaging Het
Klrb1f T C 6: 129,053,188 F64L probably benign Het
Ldlrad3 C T 2: 102,057,948 C106Y probably damaging Het
Lilra6 T C 7: 3,912,531 T161A probably benign Het
Lrriq1 A T 10: 103,161,752 M1334K possibly damaging Het
Mepe C G 5: 104,325,402 P3R probably damaging Het
Mgat4e A G 1: 134,541,118 V396A probably benign Het
Nfx1 T G 4: 40,996,877 S651A probably damaging Het
Olfr1214 T C 2: 88,987,439 I254M possibly damaging Het
Olfr1337 A T 4: 118,782,286 C100S probably damaging Het
Olfr1361 T C 13: 21,659,182 N47S probably damaging Het
Rag2 T C 2: 101,629,677 S111P probably damaging Het
Rai1 T A 11: 60,186,746 D545E probably damaging Het
Ralgps1 A G 2: 33,143,103 V498A possibly damaging Het
Rasal2 G A 1: 157,192,804 S205L probably damaging Het
Rec8 T C 14: 55,625,330 L582P probably damaging Het
Retn G A 8: 3,657,358 R106H probably damaging Het
Rnf112 A G 11: 61,452,662 L116P probably damaging Het
Rnf213 T C 11: 119,481,240 Y4885H probably damaging Het
Sacm1l A G 9: 123,582,344 I399M probably benign Het
Sez6 G T 11: 77,975,260 G738V probably damaging Het
Spata17 A G 1: 187,140,446 V56A probably benign Het
Spata31d1a A T 13: 59,701,728 V862D probably damaging Het
Sptb A G 12: 76,624,994 probably null Het
Srpk2 C A 5: 23,545,529 G59W probably damaging Het
Ttc30a1 T C 2: 75,979,744 *665W probably null Het
Tyro3 T C 2: 119,802,298 S96P probably damaging Het
Ube2v1 A G 2: 167,610,360 S108P probably damaging Het
Usp2 C T 9: 44,075,828 S141L probably benign Het
Vamp5 T C 6: 72,370,198 D46G possibly damaging Het
Vmn1r23 T A 6: 57,926,325 Q156L probably benign Het
Vmn2r6 C T 3: 64,547,408 S490N probably benign Het
Vps39 A T 2: 120,352,959 I10N probably damaging Het
Vwf C T 6: 125,645,934 Q1755* probably null Het
Wdfy4 A T 14: 33,155,760 H82Q probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Wdr72 A G 9: 74,210,561 T852A probably benign Het
Zfp1 T A 8: 111,669,723 C92* probably null Het
Zfp426 A T 9: 20,475,073 probably benign Het
Zfp442 C T 2: 150,411,210 probably null Het
Zfp74 T C 7: 29,936,045 probably benign Het
Other mutations in Eya4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Eya4 APN 10 23159097 missense probably benign 0.17
IGL00507:Eya4 APN 10 23157536 nonsense probably null
IGL01324:Eya4 APN 10 23116551 critical splice donor site probably null
IGL01350:Eya4 APN 10 23113974 missense possibly damaging 0.88
IGL01397:Eya4 APN 10 23139999 missense probably benign 0.01
IGL02682:Eya4 APN 10 23116600 missense probably damaging 1.00
IGL02688:Eya4 APN 10 23159110 missense probably benign 0.01
IGL03071:Eya4 APN 10 23323073 missense probably benign 0.07
R0420:Eya4 UTSW 10 23155963 missense possibly damaging 0.85
R1688:Eya4 UTSW 10 23123861 missense probably damaging 1.00
R2312:Eya4 UTSW 10 23106264 missense probably damaging 1.00
R3029:Eya4 UTSW 10 23123878 missense probably benign
R3853:Eya4 UTSW 10 23116676 missense probably damaging 1.00
R3872:Eya4 UTSW 10 23155972 missense probably damaging 0.97
R4113:Eya4 UTSW 10 23155951 missense probably damaging 0.98
R4210:Eya4 UTSW 10 23226800 critical splice donor site probably null
R4457:Eya4 UTSW 10 23116668 missense probably damaging 1.00
R4691:Eya4 UTSW 10 23140068 missense probably benign 0.03
R5345:Eya4 UTSW 10 23110048 missense probably benign 0.00
R5473:Eya4 UTSW 10 23163453 missense probably benign 0.02
R5547:Eya4 UTSW 10 23109854 missense possibly damaging 0.55
R5698:Eya4 UTSW 10 23140077 missense possibly damaging 0.50
R5951:Eya4 UTSW 10 23155994 missense probably damaging 1.00
R5953:Eya4 UTSW 10 23151973 missense probably damaging 1.00
R6111:Eya4 UTSW 10 23140055 missense possibly damaging 0.67
R6413:Eya4 UTSW 10 23116826 missense probably damaging 1.00
R6460:Eya4 UTSW 10 23152012 missense probably benign 0.05
R7144:Eya4 UTSW 10 23173045 missense probably benign 0.00
R7169:Eya4 UTSW 10 23155947 missense probably benign 0.42
R7358:Eya4 UTSW 10 23123851 critical splice donor site probably null
R7549:Eya4 UTSW 10 23111658 missense probably damaging 1.00
R7791:Eya4 UTSW 10 23113926 missense probably damaging 1.00
R7793:Eya4 UTSW 10 23226816 missense probably benign
Z1088:Eya4 UTSW 10 23113988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATTTGCAGGCCCACATCG -3'
(R):5'- TCAGGCAAGGAAAGCTGTTTTG -3'

Sequencing Primer
(F):5'- GGCCCACATCGACTCTCTCATG -3'
(R):5'- GTGTCCAGATTTGGCACTAAC -3'
Posted On2016-03-17