Incidental Mutation 'R4894:Lrriq1'
ID 377504
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Name leucine-rich repeats and IQ motif containing 1
Synonyms Gm1557, LOC380658, 4930503E15Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R4894 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 102881892-103072183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102997613 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1334 (M1334K)
Ref Sequence ENSEMBL: ENSMUSP00000131419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166240]
AlphaFold Q0P5X1
Predicted Effect possibly damaging
Transcript: ENSMUST00000166240
AA Change: M1334K

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: M1334K

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,609,975 (GRCm39) Y176* probably null Het
Akap13 T A 7: 75,375,068 (GRCm39) M1900K possibly damaging Het
Ankrd36 A G 11: 5,585,332 (GRCm39) E381G probably damaging Het
Ap3s1 T C 18: 46,891,183 (GRCm39) probably null Het
Cacna1e G T 1: 154,364,551 (GRCm39) S341* probably null Het
Camk1d G A 2: 5,359,539 (GRCm39) S161L probably damaging Het
Cdh23 G T 10: 60,173,630 (GRCm39) H1619Q probably benign Het
Chd7 T A 4: 8,838,629 (GRCm39) I1276N probably damaging Het
Clca3a1 A G 3: 144,719,662 (GRCm39) V436A probably damaging Het
Ctcfl G A 2: 172,959,196 (GRCm39) P177S probably benign Het
Dab2ip A G 2: 35,620,539 (GRCm39) probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Epc1 A T 18: 6,449,011 (GRCm39) S495R probably benign Het
Espl1 A G 15: 102,230,758 (GRCm39) probably null Het
Eya4 T C 10: 22,985,753 (GRCm39) E583G possibly damaging Het
Fam111a C G 19: 12,565,913 (GRCm39) T554R probably benign Het
Fbh1 A T 2: 11,767,771 (GRCm39) I359N probably damaging Het
Fer1l6 T C 15: 58,490,751 (GRCm39) C1023R probably damaging Het
Helz2 G C 2: 180,877,940 (GRCm39) P953A probably benign Het
Ifi204 G T 1: 173,587,808 (GRCm39) S117Y probably damaging Het
Ift70a1 T C 2: 75,810,088 (GRCm39) *665W probably null Het
Igfn1 G A 1: 135,882,520 (GRCm39) T2775M probably damaging Het
Igsf9 A G 1: 172,325,634 (GRCm39) T1101A probably benign Het
Ipo13 A C 4: 117,760,638 (GRCm39) I614S probably damaging Het
Ipo13 A G 4: 117,761,687 (GRCm39) I476T possibly damaging Het
Kdm2b C A 5: 123,079,030 (GRCm39) E308* probably null Het
Klhl20 A T 1: 160,937,102 (GRCm39) M91K possibly damaging Het
Klrb1f T C 6: 129,030,151 (GRCm39) F64L probably benign Het
Ldlrad3 C T 2: 101,888,293 (GRCm39) C106Y probably damaging Het
Lilra6 T C 7: 3,915,530 (GRCm39) T161A probably benign Het
Mepe C G 5: 104,473,268 (GRCm39) P3R probably damaging Het
Mgat4e A G 1: 134,468,856 (GRCm39) V396A probably benign Het
Nfx1 T G 4: 40,996,877 (GRCm39) S651A probably damaging Het
Or10ak13 A T 4: 118,639,483 (GRCm39) C100S probably damaging Het
Or2w6 T C 13: 21,843,352 (GRCm39) N47S probably damaging Het
Or4c109 T C 2: 88,817,783 (GRCm39) I254M possibly damaging Het
Rag2 T C 2: 101,460,022 (GRCm39) S111P probably damaging Het
Rai1 T A 11: 60,077,572 (GRCm39) D545E probably damaging Het
Ralgps1 A G 2: 33,033,115 (GRCm39) V498A possibly damaging Het
Rasal2 G A 1: 157,020,374 (GRCm39) S205L probably damaging Het
Rec8 T C 14: 55,862,787 (GRCm39) L582P probably damaging Het
Retn G A 8: 3,707,358 (GRCm39) R106H probably damaging Het
Rnf112 A G 11: 61,343,488 (GRCm39) L116P probably damaging Het
Rnf213 T C 11: 119,372,066 (GRCm39) Y4885H probably damaging Het
Sacm1l A G 9: 123,411,409 (GRCm39) I399M probably benign Het
Sez6 G T 11: 77,866,086 (GRCm39) G738V probably damaging Het
Spata17 A G 1: 186,872,643 (GRCm39) V56A probably benign Het
Spata31d1a A T 13: 59,849,542 (GRCm39) V862D probably damaging Het
Sptb A G 12: 76,671,768 (GRCm39) probably null Het
Srpk2 C A 5: 23,750,527 (GRCm39) G59W probably damaging Het
Tyro3 T C 2: 119,632,779 (GRCm39) S96P probably damaging Het
Ube2v1 A G 2: 167,452,280 (GRCm39) S108P probably damaging Het
Usp2 C T 9: 43,987,125 (GRCm39) S141L probably benign Het
Vamp5 T C 6: 72,347,181 (GRCm39) D46G possibly damaging Het
Vmn1r23 T A 6: 57,903,310 (GRCm39) Q156L probably benign Het
Vmn2r6 C T 3: 64,454,829 (GRCm39) S490N probably benign Het
Vps39 A T 2: 120,183,440 (GRCm39) I10N probably damaging Het
Vwf C T 6: 125,622,897 (GRCm39) Q1755* probably null Het
Wdfy4 A T 14: 32,877,717 (GRCm39) H82Q probably benign Het
Wdr24 T C 17: 26,045,101 (GRCm39) Y279H probably damaging Het
Wdr72 A G 9: 74,117,843 (GRCm39) T852A probably benign Het
Zfp1 T A 8: 112,396,355 (GRCm39) C92* probably null Het
Zfp1004 T A 2: 150,033,899 (GRCm39) C104* probably null Het
Zfp426 A T 9: 20,386,369 (GRCm39) probably benign Het
Zfp442 C T 2: 150,253,130 (GRCm39) probably null Het
Zfp74 T C 7: 29,635,470 (GRCm39) probably benign Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 102,997,757 (GRCm39) missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103,053,977 (GRCm39) nonsense probably null
IGL01637:Lrriq1 APN 10 103,051,489 (GRCm39) missense probably benign
IGL02019:Lrriq1 APN 10 103,014,661 (GRCm39) missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103,006,340 (GRCm39) missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103,060,802 (GRCm39) missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103,070,024 (GRCm39) splice site probably benign
IGL02408:Lrriq1 APN 10 102,982,142 (GRCm39) missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103,036,500 (GRCm39) missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103,050,880 (GRCm39) missense probably benign 0.02
IGL02558:Lrriq1 APN 10 102,982,144 (GRCm39) missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 102,980,409 (GRCm39) missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103,057,322 (GRCm39) critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103,063,057 (GRCm39) missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 102,907,055 (GRCm39) missense probably benign 0.26
R0050:Lrriq1 UTSW 10 102,904,792 (GRCm39) missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 102,904,792 (GRCm39) missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 102,899,279 (GRCm39) missense probably benign 0.02
R0068:Lrriq1 UTSW 10 102,899,279 (GRCm39) missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103,006,281 (GRCm39) critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103,051,634 (GRCm39) missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103,057,150 (GRCm39) missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 102,904,829 (GRCm39) splice site probably null
R0522:Lrriq1 UTSW 10 102,997,638 (GRCm39) missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103,069,905 (GRCm39) missense probably benign
R1220:Lrriq1 UTSW 10 102,906,990 (GRCm39) missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103,069,998 (GRCm39) missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103,069,998 (GRCm39) missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103,038,376 (GRCm39) splice site probably benign
R1642:Lrriq1 UTSW 10 103,050,317 (GRCm39) missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103,050,685 (GRCm39) missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103,006,509 (GRCm39) nonsense probably null
R1830:Lrriq1 UTSW 10 102,997,620 (GRCm39) missense probably benign
R1843:Lrriq1 UTSW 10 103,063,034 (GRCm39) splice site probably null
R2128:Lrriq1 UTSW 10 103,050,718 (GRCm39) missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103,050,718 (GRCm39) missense probably benign 0.01
R2199:Lrriq1 UTSW 10 102,904,774 (GRCm39) missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103,025,848 (GRCm39) missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103,038,242 (GRCm39) missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103,063,111 (GRCm39) missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103,063,111 (GRCm39) missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103,050,536 (GRCm39) missense probably benign 0.00
R2939:Lrriq1 UTSW 10 102,980,750 (GRCm39) missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R3081:Lrriq1 UTSW 10 102,980,750 (GRCm39) missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103,006,294 (GRCm39) missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103,006,717 (GRCm39) missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103,051,972 (GRCm39) missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103,051,972 (GRCm39) missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103,051,967 (GRCm39) missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103,038,225 (GRCm39) missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103,057,288 (GRCm39) missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103,036,424 (GRCm39) nonsense probably null
R4663:Lrriq1 UTSW 10 102,899,273 (GRCm39) missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103,051,610 (GRCm39) missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103,006,327 (GRCm39) missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103,057,179 (GRCm39) missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103,057,179 (GRCm39) missense probably benign 0.02
R4815:Lrriq1 UTSW 10 102,980,739 (GRCm39) missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103,014,649 (GRCm39) missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103,069,899 (GRCm39) missense possibly damaging 0.88
R4990:Lrriq1 UTSW 10 103,036,420 (GRCm39) missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103,036,420 (GRCm39) missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103,025,784 (GRCm39) missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103,025,784 (GRCm39) missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103,023,314 (GRCm39) missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103,051,206 (GRCm39) missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103,050,448 (GRCm39) missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103,006,457 (GRCm39) missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103,051,301 (GRCm39) missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103,009,236 (GRCm39) missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103,057,243 (GRCm39) nonsense probably null
R6008:Lrriq1 UTSW 10 103,006,325 (GRCm39) missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103,051,395 (GRCm39) missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103,051,618 (GRCm39) missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103,051,312 (GRCm39) missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103,009,254 (GRCm39) missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103,036,559 (GRCm39) missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103,063,045 (GRCm39) missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103,057,293 (GRCm39) missense probably benign 0.06
R6719:Lrriq1 UTSW 10 102,906,977 (GRCm39) missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103,017,750 (GRCm39) critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103,050,800 (GRCm39) missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103,023,319 (GRCm39) missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103,060,826 (GRCm39) missense probably benign
R7241:Lrriq1 UTSW 10 103,051,834 (GRCm39) missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103,059,611 (GRCm39) missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103,051,877 (GRCm39) missense probably benign 0.00
R7402:Lrriq1 UTSW 10 103,057,185 (GRCm39) missense possibly damaging 0.87
R7439:Lrriq1 UTSW 10 103,050,380 (GRCm39) missense probably benign 0.21
R7585:Lrriq1 UTSW 10 103,050,807 (GRCm39) missense possibly damaging 0.93
R7611:Lrriq1 UTSW 10 103,036,432 (GRCm39) missense possibly damaging 0.54
R7634:Lrriq1 UTSW 10 103,036,462 (GRCm39) missense probably damaging 1.00
R7767:Lrriq1 UTSW 10 103,051,815 (GRCm39) missense probably damaging 0.99
R7809:Lrriq1 UTSW 10 103,051,678 (GRCm39) missense probably damaging 0.99
R7910:Lrriq1 UTSW 10 103,051,055 (GRCm39) nonsense probably null
R8131:Lrriq1 UTSW 10 103,051,572 (GRCm39) missense possibly damaging 0.57
R8156:Lrriq1 UTSW 10 102,992,196 (GRCm39) critical splice donor site probably null
R8211:Lrriq1 UTSW 10 103,006,408 (GRCm39) missense probably damaging 1.00
R8304:Lrriq1 UTSW 10 103,069,929 (GRCm39) missense possibly damaging 0.57
R8487:Lrriq1 UTSW 10 103,050,914 (GRCm39) missense probably damaging 0.98
R8500:Lrriq1 UTSW 10 102,882,016 (GRCm39) missense
R9013:Lrriq1 UTSW 10 103,050,931 (GRCm39) missense probably damaging 1.00
R9099:Lrriq1 UTSW 10 103,051,864 (GRCm39) missense probably damaging 0.98
R9155:Lrriq1 UTSW 10 103,050,640 (GRCm39) missense probably benign 0.03
R9320:Lrriq1 UTSW 10 103,057,144 (GRCm39) missense probably benign
R9384:Lrriq1 UTSW 10 103,006,458 (GRCm39) missense probably benign 0.00
R9469:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R9585:Lrriq1 UTSW 10 103,051,250 (GRCm39) missense probably benign
R9706:Lrriq1 UTSW 10 102,881,902 (GRCm39) missense
R9780:Lrriq1 UTSW 10 103,025,824 (GRCm39) missense probably damaging 1.00
X0026:Lrriq1 UTSW 10 103,051,565 (GRCm39) nonsense probably null
Z1088:Lrriq1 UTSW 10 103,038,307 (GRCm39) missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103,069,946 (GRCm39) missense probably damaging 0.99
Z1176:Lrriq1 UTSW 10 103,038,221 (GRCm39) missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103,038,220 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCAGCCTGTAAATCCAAG -3'
(R):5'- ACCATATTTTCAGCATCTTATCAAGA -3'

Sequencing Primer
(F):5'- CCTGTAAATCCAAGCAAGTGTG -3'
(R):5'- GGCGTAGTTACATTGCAC -3'
Posted On 2016-03-17