Mutagenetix > Incidental Mutation

Incidental Mutation 'R4894:Lrriq1'

377504

Institutional Source

Beutler Lab

Gene Symbol

Lrriq1

Ensembl Gene

ENSMUSG00000019892

Gene Name

leucine-rich repeats and IQ motif containing 1

Synonyms

LOC380658, 4930503E15Rik, Gm1557

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R4894 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103046031-103236322 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 103161752 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1334 (M1334K)

Ref Sequence

ENSEMBL: ENSMUSP00000131419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166240]

AlphaFold

Q0P5X1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166240
AA Change: M1334K

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: M1334K

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
IQ	290	312	9.78e1	SMART
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
LRR	873	894	2.14e1	SMART
LRR	895	917	4.45e1	SMART
LRR	984	1005	2.03e2	SMART
LRR	1029	1052	3.65e0	SMART
low complexity region	1244	1258	N/A	INTRINSIC
IQ	1279	1301	5.61e1	SMART
IQ	1339	1361	6.7e-3	SMART
low complexity region	1369	1394	N/A	INTRINSIC
low complexity region	1502	1518	N/A	INTRINSIC
low complexity region	1528	1543	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf1	C	A	17: 43,299,084	Y176*	probably null	Het
Akap13	T	A	7: 75,725,320	M1900K	possibly damaging	Het
Ankrd36	A	G	11: 5,635,332	E381G	probably damaging	Het
Ap3s1	T	C	18: 46,758,116		probably null	Het
Cacna1e	G	T	1: 154,488,805	S341*	probably null	Het
Camk1d	G	A	2: 5,354,728	S161L	probably damaging	Het
Cdh23	G	T	10: 60,337,851	H1619Q	probably benign	Het
Chd7	T	A	4: 8,838,629	I1276N	probably damaging	Het
Clca1	A	G	3: 145,013,901	V436A	probably damaging	Het
Ctcfl	G	A	2: 173,117,403	P177S	probably benign	Het
Dab2ip	A	G	2: 35,730,527		probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Epc1	A	T	18: 6,449,011	S495R	probably benign	Het
Espl1	A	G	15: 102,322,323		probably null	Het
Eya4	T	C	10: 23,109,854	E583G	possibly damaging	Het
Fam111a	C	G	19: 12,588,549	T554R	probably benign	Het
Fbxo18	A	T	2: 11,762,960	I359N	probably damaging	Het
Fer1l6	T	C	15: 58,618,902	C1023R	probably damaging	Het
Gm14139	T	A	2: 150,191,979	C104*	probably null	Het
Helz2	G	C	2: 181,236,147	P953A	probably benign	Het
Ifi204	G	T	1: 173,760,242	S117Y	probably damaging	Het
Igfn1	G	A	1: 135,954,782	T2775M	probably damaging	Het
Igsf9	A	G	1: 172,498,067	T1101A	probably benign	Het
Ipo13	A	C	4: 117,903,441	I614S	probably damaging	Het
Ipo13	A	G	4: 117,904,490	I476T	possibly damaging	Het
Kdm2b	C	A	5: 122,940,967	E308*	probably null	Het
Klhl20	A	T	1: 161,109,532	M91K	possibly damaging	Het
Klrb1f	T	C	6: 129,053,188	F64L	probably benign	Het
Ldlrad3	C	T	2: 102,057,948	C106Y	probably damaging	Het
Lilra6	T	C	7: 3,912,531	T161A	probably benign	Het
Mepe	C	G	5: 104,325,402	P3R	probably damaging	Het
Mgat4e	A	G	1: 134,541,118	V396A	probably benign	Het
Nfx1	T	G	4: 40,996,877	S651A	probably damaging	Het
Olfr1214	T	C	2: 88,987,439	I254M	possibly damaging	Het
Olfr1337	A	T	4: 118,782,286	C100S	probably damaging	Het
Olfr1361	T	C	13: 21,659,182	N47S	probably damaging	Het
Rag2	T	C	2: 101,629,677	S111P	probably damaging	Het
Rai1	T	A	11: 60,186,746	D545E	probably damaging	Het
Ralgps1	A	G	2: 33,143,103	V498A	possibly damaging	Het
Rasal2	G	A	1: 157,192,804	S205L	probably damaging	Het
Rec8	T	C	14: 55,625,330	L582P	probably damaging	Het
Retn	G	A	8: 3,657,358	R106H	probably damaging	Het
Rnf112	A	G	11: 61,452,662	L116P	probably damaging	Het
Rnf213	T	C	11: 119,481,240	Y4885H	probably damaging	Het
Sacm1l	A	G	9: 123,582,344	I399M	probably benign	Het
Sez6	G	T	11: 77,975,260	G738V	probably damaging	Het
Spata17	A	G	1: 187,140,446	V56A	probably benign	Het
Spata31d1a	A	T	13: 59,701,728	V862D	probably damaging	Het
Sptb	A	G	12: 76,624,994		probably null	Het
Srpk2	C	A	5: 23,545,529	G59W	probably damaging	Het
Ttc30a1	T	C	2: 75,979,744	*665W	probably null	Het
Tyro3	T	C	2: 119,802,298	S96P	probably damaging	Het
Ube2v1	A	G	2: 167,610,360	S108P	probably damaging	Het
Usp2	C	T	9: 44,075,828	S141L	probably benign	Het
Vamp5	T	C	6: 72,370,198	D46G	possibly damaging	Het
Vmn1r23	T	A	6: 57,926,325	Q156L	probably benign	Het
Vmn2r6	C	T	3: 64,547,408	S490N	probably benign	Het
Vps39	A	T	2: 120,352,959	I10N	probably damaging	Het
Vwf	C	T	6: 125,645,934	Q1755*	probably null	Het
Wdfy4	A	T	14: 33,155,760	H82Q	probably benign	Het
Wdr24	T	C	17: 25,826,127	Y279H	probably damaging	Het
Wdr72	A	G	9: 74,210,561	T852A	probably benign	Het
Zfp1	T	A	8: 111,669,723	C92*	probably null	Het
Zfp426	A	T	9: 20,475,073		probably benign	Het
Zfp442	C	T	2: 150,411,210		probably null	Het
Zfp74	T	C	7: 29,936,045		probably benign	Het

Other mutations in Lrriq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Lrriq1	APN	10	103161896	missense	probably damaging	0.99
IGL01523:Lrriq1	APN	10	103218116	nonsense	probably null
IGL01637:Lrriq1	APN	10	103215628	missense	probably benign
IGL02019:Lrriq1	APN	10	103178800	missense	probably benign	0.02
IGL02153:Lrriq1	APN	10	103170479	missense	probably benign	0.01
IGL02341:Lrriq1	APN	10	103224941	missense	probably benign	0.03
IGL02343:Lrriq1	APN	10	103234163	splice site	probably benign
IGL02408:Lrriq1	APN	10	103146281	missense	probably benign	0.17
IGL02431:Lrriq1	APN	10	103200639	missense	probably damaging	1.00
IGL02540:Lrriq1	APN	10	103215019	missense	probably benign	0.02
IGL02558:Lrriq1	APN	10	103146283	missense	probably damaging	1.00
IGL02613:Lrriq1	APN	10	103144548	missense	probably damaging	0.99
IGL02642:Lrriq1	APN	10	103221461	critical splice acceptor site	probably null
IGL03027:Lrriq1	APN	10	103227196	missense	probably benign	0.35
PIT4362001:Lrriq1	UTSW	10	103071194	missense	probably benign	0.26
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0124:Lrriq1	UTSW	10	103170420	critical splice donor site	probably null
R0244:Lrriq1	UTSW	10	103215773	missense	probably damaging	0.98
R0323:Lrriq1	UTSW	10	103221289	missense	possibly damaging	0.91
R0515:Lrriq1	UTSW	10	103068968	splice site	probably null
R0522:Lrriq1	UTSW	10	103161777	missense	probably damaging	0.99
R0701:Lrriq1	UTSW	10	103234044	missense	probably benign
R1220:Lrriq1	UTSW	10	103071129	missense	probably benign	0.05
R1261:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1262:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1451:Lrriq1	UTSW	10	103202515	splice site	probably benign
R1642:Lrriq1	UTSW	10	103214456	missense	probably benign	0.13
R1643:Lrriq1	UTSW	10	103214824	missense	probably benign	0.00
R1647:Lrriq1	UTSW	10	103170648	nonsense	probably null
R1830:Lrriq1	UTSW	10	103161759	missense	probably benign
R1843:Lrriq1	UTSW	10	103227173	splice site	probably null
R2128:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2129:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2199:Lrriq1	UTSW	10	103068913	missense	probably damaging	1.00
R2354:Lrriq1	UTSW	10	103189987	missense	probably damaging	1.00
R2495:Lrriq1	UTSW	10	103202381	missense	probably damaging	0.97
R2897:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2898:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2922:Lrriq1	UTSW	10	103214675	missense	probably benign	0.00
R2939:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R2965:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R2966:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R3081:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R3115:Lrriq1	UTSW	10	103170433	missense	probably benign	0.00
R3745:Lrriq1	UTSW	10	103170856	missense	probably damaging	0.99
R3813:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3814:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3885:Lrriq1	UTSW	10	103216106	missense	probably damaging	0.96
R4378:Lrriq1	UTSW	10	103202364	missense	probably damaging	1.00
R4632:Lrriq1	UTSW	10	103221427	missense	probably damaging	1.00
R4633:Lrriq1	UTSW	10	103200563	nonsense	probably null
R4663:Lrriq1	UTSW	10	103063412	missense	possibly damaging	0.88
R4702:Lrriq1	UTSW	10	103215749	missense	possibly damaging	0.65
R4793:Lrriq1	UTSW	10	103170466	missense	probably benign	0.25
R4801:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4802:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4815:Lrriq1	UTSW	10	103144878	missense	probably benign	0.10
R4872:Lrriq1	UTSW	10	103178788	missense	possibly damaging	0.56
R4877:Lrriq1	UTSW	10	103234038	missense	possibly damaging	0.88
R4990:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R4991:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R5011:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5013:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5122:Lrriq1	UTSW	10	103187453	missense	probably damaging	1.00
R5282:Lrriq1	UTSW	10	103215345	missense	probably benign	0.01
R5311:Lrriq1	UTSW	10	103214587	missense	probably damaging	1.00
R5567:Lrriq1	UTSW	10	103170596	missense	possibly damaging	0.56
R5643:Lrriq1	UTSW	10	103215440	missense	probably benign	0.00
R5683:Lrriq1	UTSW	10	103173375	missense	probably damaging	1.00
R5916:Lrriq1	UTSW	10	103221382	nonsense	probably null
R6008:Lrriq1	UTSW	10	103170464	missense	probably damaging	1.00
R6022:Lrriq1	UTSW	10	103215534	missense	possibly damaging	0.90
R6224:Lrriq1	UTSW	10	103215757	missense	probably damaging	1.00
R6254:Lrriq1	UTSW	10	103215451	missense	probably benign	0.15
R6311:Lrriq1	UTSW	10	103173393	missense	probably benign	0.03
R6460:Lrriq1	UTSW	10	103200698	missense	probably damaging	1.00
R6502:Lrriq1	UTSW	10	103227184	missense	probably damaging	0.99
R6637:Lrriq1	UTSW	10	103221432	missense	probably benign	0.06
R6719:Lrriq1	UTSW	10	103071116	missense	probably damaging	1.00
R6736:Lrriq1	UTSW	10	103181889	critical splice acceptor site	probably null
R6928:Lrriq1	UTSW	10	103214939	missense	possibly damaging	0.95
R6991:Lrriq1	UTSW	10	103187458	missense	probably damaging	1.00
R7174:Lrriq1	UTSW	10	103224965	missense	probably benign
R7241:Lrriq1	UTSW	10	103215973	missense	probably damaging	1.00
R7248:Lrriq1	UTSW	10	103223750	missense	possibly damaging	0.85
R7287:Lrriq1	UTSW	10	103216016	missense	probably benign	0.00
R7402:Lrriq1	UTSW	10	103221324	missense	possibly damaging	0.87
R7439:Lrriq1	UTSW	10	103214519	missense	probably benign	0.21
R7585:Lrriq1	UTSW	10	103214946	missense	possibly damaging	0.93
R7611:Lrriq1	UTSW	10	103200571	missense	possibly damaging	0.54
R7634:Lrriq1	UTSW	10	103200601	missense	probably damaging	1.00
R7767:Lrriq1	UTSW	10	103215954	missense	probably damaging	0.99
R7809:Lrriq1	UTSW	10	103215817	missense	probably damaging	0.99
R7910:Lrriq1	UTSW	10	103215194	nonsense	probably null
R8131:Lrriq1	UTSW	10	103215711	missense	possibly damaging	0.57
R8156:Lrriq1	UTSW	10	103156335	critical splice donor site	probably null
R8211:Lrriq1	UTSW	10	103170547	missense	probably damaging	1.00
R8304:Lrriq1	UTSW	10	103234068	missense	possibly damaging	0.57
R8487:Lrriq1	UTSW	10	103215053	missense	probably damaging	0.98
R8500:Lrriq1	UTSW	10	103046155	missense
R9013:Lrriq1	UTSW	10	103215070	missense	probably damaging	1.00
R9099:Lrriq1	UTSW	10	103216003	missense	probably damaging	0.98
R9155:Lrriq1	UTSW	10	103214779	missense	probably benign	0.03
R9320:Lrriq1	UTSW	10	103221283	missense	probably benign
R9384:Lrriq1	UTSW	10	103170597	missense	probably benign	0.00
R9469:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R9585:Lrriq1	UTSW	10	103215389	missense	probably benign
R9706:Lrriq1	UTSW	10	103046041	missense
R9780:Lrriq1	UTSW	10	103189963	missense	probably damaging	1.00
X0026:Lrriq1	UTSW	10	103215704	nonsense	probably null
Z1088:Lrriq1	UTSW	10	103202446	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202359	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202360	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103234085	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTTGCAGCCTGTAAATCCAAG -3'
(R):5'- ACCATATTTTCAGCATCTTATCAAGA -3'

Sequencing Primer
(F):5'- CCTGTAAATCCAAGCAAGTGTG -3'
(R):5'- GGCGTAGTTACATTGCAC -3'

Posted On

2016-03-17