Incidental Mutation 'R4894:Ankrd36'
ID377505
Institutional Source Beutler Lab
Gene Symbol Ankrd36
Ensembl Gene ENSMUSG00000020481
Gene Nameankyrin repeat domain 36
Synonyms1700012M14Rik, 1700008J08Rik, GC3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R4894 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location5569684-5689337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5635332 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 381 (E381G)
Ref Sequence ENSEMBL: ENSMUSP00000120499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109856] [ENSMUST00000118112] [ENSMUST00000137933]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109856
AA Change: E1023G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105482
Gene: ENSMUSG00000020481
AA Change: E1023G

DomainStartEndE-ValueType
Blast:ANK 29 62 3e-12 BLAST
ANK 66 95 4.5e-3 SMART
ANK 99 128 1.44e-1 SMART
ANK 132 161 4.6e0 SMART
ANK 165 194 2.48e-5 SMART
ANK 198 227 4.67e-1 SMART
internal_repeat_1 449 555 1.04e-5 PROSPERO
internal_repeat_1 891 981 1.04e-5 PROSPERO
low complexity region 1105 1118 N/A INTRINSIC
coiled coil region 1268 1297 N/A INTRINSIC
coiled coil region 1318 1338 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118112
AA Change: E1056G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122397
Gene: ENSMUSG00000020481
AA Change: E1056G

DomainStartEndE-ValueType
Blast:ANK 29 62 3e-12 BLAST
ANK 66 95 2.9e-5 SMART
ANK 99 128 9.4e-4 SMART
ANK 132 161 2.9e-2 SMART
ANK 165 194 1.5e-7 SMART
ANK 198 227 2.9e-3 SMART
internal_repeat_1 255 352 8.15e-5 PROSPERO
internal_repeat_1 438 538 8.15e-5 PROSPERO
low complexity region 1138 1151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120982
Predicted Effect probably damaging
Transcript: ENSMUST00000137933
AA Change: E381G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120499
Gene: ENSMUSG00000020481
AA Change: E381G

DomainStartEndE-ValueType
low complexity region 463 476 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,299,084 Y176* probably null Het
Akap13 T A 7: 75,725,320 M1900K possibly damaging Het
Ap3s1 T C 18: 46,758,116 probably null Het
Cacna1e G T 1: 154,488,805 S341* probably null Het
Camk1d G A 2: 5,354,728 S161L probably damaging Het
Cdh23 G T 10: 60,337,851 H1619Q probably benign Het
Chd7 T A 4: 8,838,629 I1276N probably damaging Het
Clca1 A G 3: 145,013,901 V436A probably damaging Het
Ctcfl G A 2: 173,117,403 P177S probably benign Het
Dab2ip A G 2: 35,730,527 probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epc1 A T 18: 6,449,011 S495R probably benign Het
Espl1 A G 15: 102,322,323 probably null Het
Eya4 T C 10: 23,109,854 E583G possibly damaging Het
Fam111a C G 19: 12,588,549 T554R probably benign Het
Fbxo18 A T 2: 11,762,960 I359N probably damaging Het
Fer1l6 T C 15: 58,618,902 C1023R probably damaging Het
Gm14139 T A 2: 150,191,979 C104* probably null Het
Helz2 G C 2: 181,236,147 P953A probably benign Het
Ifi204 G T 1: 173,760,242 S117Y probably damaging Het
Igfn1 G A 1: 135,954,782 T2775M probably damaging Het
Igsf9 A G 1: 172,498,067 T1101A probably benign Het
Ipo13 A C 4: 117,903,441 I614S probably damaging Het
Ipo13 A G 4: 117,904,490 I476T possibly damaging Het
Kdm2b C A 5: 122,940,967 E308* probably null Het
Klhl20 A T 1: 161,109,532 M91K possibly damaging Het
Klrb1f T C 6: 129,053,188 F64L probably benign Het
Ldlrad3 C T 2: 102,057,948 C106Y probably damaging Het
Lilra6 T C 7: 3,912,531 T161A probably benign Het
Lrriq1 A T 10: 103,161,752 M1334K possibly damaging Het
Mepe C G 5: 104,325,402 P3R probably damaging Het
Mgat4e A G 1: 134,541,118 V396A probably benign Het
Nfx1 T G 4: 40,996,877 S651A probably damaging Het
Olfr1214 T C 2: 88,987,439 I254M possibly damaging Het
Olfr1337 A T 4: 118,782,286 C100S probably damaging Het
Olfr1361 T C 13: 21,659,182 N47S probably damaging Het
Rag2 T C 2: 101,629,677 S111P probably damaging Het
Rai1 T A 11: 60,186,746 D545E probably damaging Het
Ralgps1 A G 2: 33,143,103 V498A possibly damaging Het
Rasal2 G A 1: 157,192,804 S205L probably damaging Het
Rec8 T C 14: 55,625,330 L582P probably damaging Het
Retn G A 8: 3,657,358 R106H probably damaging Het
Rnf112 A G 11: 61,452,662 L116P probably damaging Het
Rnf213 T C 11: 119,481,240 Y4885H probably damaging Het
Sacm1l A G 9: 123,582,344 I399M probably benign Het
Sez6 G T 11: 77,975,260 G738V probably damaging Het
Spata17 A G 1: 187,140,446 V56A probably benign Het
Spata31d1a A T 13: 59,701,728 V862D probably damaging Het
Sptb A G 12: 76,624,994 probably null Het
Srpk2 C A 5: 23,545,529 G59W probably damaging Het
Ttc30a1 T C 2: 75,979,744 *665W probably null Het
Tyro3 T C 2: 119,802,298 S96P probably damaging Het
Ube2v1 A G 2: 167,610,360 S108P probably damaging Het
Usp2 C T 9: 44,075,828 S141L probably benign Het
Vamp5 T C 6: 72,370,198 D46G possibly damaging Het
Vmn1r23 T A 6: 57,926,325 Q156L probably benign Het
Vmn2r6 C T 3: 64,547,408 S490N probably benign Het
Vps39 A T 2: 120,352,959 I10N probably damaging Het
Vwf C T 6: 125,645,934 Q1755* probably null Het
Wdfy4 A T 14: 33,155,760 H82Q probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Wdr72 A G 9: 74,210,561 T852A probably benign Het
Zfp1 T A 8: 111,669,723 C92* probably null Het
Zfp426 A T 9: 20,475,073 probably benign Het
Zfp442 C T 2: 150,411,210 probably null Het
Zfp74 T C 7: 29,936,045 probably benign Het
Other mutations in Ankrd36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ankrd36 APN 11 5620131 missense probably benign 0.01
IGL01361:Ankrd36 APN 11 5596706 splice site probably benign
IGL01370:Ankrd36 APN 11 5584019 missense probably benign 0.06
IGL01384:Ankrd36 APN 11 5628348 missense probably benign 0.33
IGL01484:Ankrd36 APN 11 5629006 missense possibly damaging 0.90
IGL01524:Ankrd36 APN 11 5635092 missense probably benign
IGL01700:Ankrd36 APN 11 5632198 missense probably benign 0.05
IGL02322:Ankrd36 APN 11 5614619 missense possibly damaging 0.86
IGL02511:Ankrd36 APN 11 5660845 unclassified probably null
IGL02824:Ankrd36 APN 11 5574246 missense possibly damaging 0.67
IGL03204:Ankrd36 APN 11 5584023 missense possibly damaging 0.70
PIT4508001:Ankrd36 UTSW 11 5607137 missense possibly damaging 0.53
R0058:Ankrd36 UTSW 11 5630691 splice site probably benign
R0058:Ankrd36 UTSW 11 5630691 splice site probably benign
R0304:Ankrd36 UTSW 11 5628981 missense possibly damaging 0.55
R0504:Ankrd36 UTSW 11 5629274 missense probably damaging 0.99
R0550:Ankrd36 UTSW 11 5607429 critical splice donor site probably null
R0563:Ankrd36 UTSW 11 5629322 missense probably benign 0.33
R0891:Ankrd36 UTSW 11 5687316 missense possibly damaging 0.72
R1018:Ankrd36 UTSW 11 5646876 unclassified probably benign
R1468:Ankrd36 UTSW 11 5575752 missense probably damaging 0.99
R1468:Ankrd36 UTSW 11 5575752 missense probably damaging 0.99
R1558:Ankrd36 UTSW 11 5635329 missense probably damaging 0.99
R1663:Ankrd36 UTSW 11 5620126 missense possibly damaging 0.70
R1682:Ankrd36 UTSW 11 5607143 missense possibly damaging 0.84
R1898:Ankrd36 UTSW 11 5575683 missense probably benign 0.33
R2019:Ankrd36 UTSW 11 5689140 missense probably benign
R2032:Ankrd36 UTSW 11 5628616 missense possibly damaging 0.86
R2084:Ankrd36 UTSW 11 5662378 nonsense probably null
R4097:Ankrd36 UTSW 11 5628703 missense possibly damaging 0.85
R4572:Ankrd36 UTSW 11 5689340 unclassified probably null
R4601:Ankrd36 UTSW 11 5570102 missense probably benign 0.04
R4770:Ankrd36 UTSW 11 5590870 missense possibly damaging 0.73
R4777:Ankrd36 UTSW 11 5607120 missense probably benign
R5288:Ankrd36 UTSW 11 5689340 unclassified probably benign
R5366:Ankrd36 UTSW 11 5592841 nonsense probably null
R5384:Ankrd36 UTSW 11 5689340 unclassified probably benign
R5385:Ankrd36 UTSW 11 5689340 unclassified probably benign
R6109:Ankrd36 UTSW 11 5628941 missense probably damaging 0.98
R6155:Ankrd36 UTSW 11 5687442 missense probably benign 0.00
R6186:Ankrd36 UTSW 11 5643812 missense possibly damaging 0.81
R6289:Ankrd36 UTSW 11 5628837 missense probably damaging 0.96
R6476:Ankrd36 UTSW 11 5628753 missense probably benign 0.05
R6816:Ankrd36 UTSW 11 5643765 missense possibly damaging 0.66
R6880:Ankrd36 UTSW 11 5628748 missense probably damaging 0.99
R6919:Ankrd36 UTSW 11 5629299 missense probably benign
R7007:Ankrd36 UTSW 11 5689168 missense probably benign 0.00
R7515:Ankrd36 UTSW 11 5628905 missense possibly damaging 0.94
R7617:Ankrd36 UTSW 11 5687348 missense probably benign 0.33
R7684:Ankrd36 UTSW 11 5570113 missense possibly damaging 0.49
R7746:Ankrd36 UTSW 11 5687451 missense possibly damaging 0.96
R7783:Ankrd36 UTSW 11 5635359 missense probably damaging 0.99
R7790:Ankrd36 UTSW 11 5635176 missense possibly damaging 0.80
R8221:Ankrd36 UTSW 11 5584016 missense possibly damaging 0.53
RF004:Ankrd36 UTSW 11 5662411 missense possibly damaging 0.53
U24488:Ankrd36 UTSW 11 5630772 missense probably damaging 0.99
Z1176:Ankrd36 UTSW 11 5615538 missense probably benign
Z1177:Ankrd36 UTSW 11 5571117 missense probably damaging 0.97
Z1177:Ankrd36 UTSW 11 5629345 missense probably benign 0.01
Z1177:Ankrd36 UTSW 11 5643738 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGACCTCTCAAAGACGTGCC -3'
(R):5'- TCGTGTTCAGACCAAGAGCAAG -3'

Sequencing Primer
(F):5'- AGAGCGCACCTGCAGATC -3'
(R):5'- GAGGGAAGACATTTTTCCCTGTACC -3'
Posted On2016-03-17