Incidental Mutation 'R4894:Rai1'
ID377506
Institutional Source Beutler Lab
Gene Symbol Rai1
Ensembl Gene ENSMUSG00000062115
Gene Nameretinoic acid induced 1
SynonymsGt1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4894 (G1)
Quality Score217
Status Not validated
Chromosome11
Chromosomal Location60105013-60199197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60186746 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 545 (D545E)
Ref Sequence ENSEMBL: ENSMUSP00000126183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064190] [ENSMUST00000090806] [ENSMUST00000102688] [ENSMUST00000132012] [ENSMUST00000171108]
Predicted Effect probably damaging
Transcript: ENSMUST00000064190
AA Change: D545E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070896
Gene: ENSMUSG00000062115
AA Change: D545E

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090806
AA Change: D545E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088315
Gene: ENSMUSG00000062115
AA Change: D545E

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102688
AA Change: D545E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099749
Gene: ENSMUSG00000062115
AA Change: D545E

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132012
SMART Domains Protein: ENSMUSP00000118543
Gene: ENSMUSG00000062115

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149770
Predicted Effect probably damaging
Transcript: ENSMUST00000171108
AA Change: D545E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126183
Gene: ENSMUSG00000062115
AA Change: D545E

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within the Smith-Magenis syndrome region on chromosome 17. It is highly similar to its mouse counterpart and is expressed at high levels mainly in neuronal tissues. The protein encoded by this gene includes a polymorphic polyglutamine tract in the N-terminal domain. Expression of the mouse counterpart in neurons is induced by retinoic acid. This gene is associated with both the severity of the phenotype and the response to medication in schizophrenic patients. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene usually die as embryos. Survivors have shortened life spans and show severe craniofacial and axial skeleton defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,299,084 Y176* probably null Het
Akap13 T A 7: 75,725,320 M1900K possibly damaging Het
Ankrd36 A G 11: 5,635,332 E381G probably damaging Het
Ap3s1 T C 18: 46,758,116 probably null Het
Cacna1e G T 1: 154,488,805 S341* probably null Het
Camk1d G A 2: 5,354,728 S161L probably damaging Het
Cdh23 G T 10: 60,337,851 H1619Q probably benign Het
Chd7 T A 4: 8,838,629 I1276N probably damaging Het
Clca1 A G 3: 145,013,901 V436A probably damaging Het
Ctcfl G A 2: 173,117,403 P177S probably benign Het
Dab2ip A G 2: 35,730,527 probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epc1 A T 18: 6,449,011 S495R probably benign Het
Espl1 A G 15: 102,322,323 probably null Het
Eya4 T C 10: 23,109,854 E583G possibly damaging Het
Fam111a C G 19: 12,588,549 T554R probably benign Het
Fbxo18 A T 2: 11,762,960 I359N probably damaging Het
Fer1l6 T C 15: 58,618,902 C1023R probably damaging Het
Gm14139 T A 2: 150,191,979 C104* probably null Het
Helz2 G C 2: 181,236,147 P953A probably benign Het
Ifi204 G T 1: 173,760,242 S117Y probably damaging Het
Igfn1 G A 1: 135,954,782 T2775M probably damaging Het
Igsf9 A G 1: 172,498,067 T1101A probably benign Het
Ipo13 A C 4: 117,903,441 I614S probably damaging Het
Ipo13 A G 4: 117,904,490 I476T possibly damaging Het
Kdm2b C A 5: 122,940,967 E308* probably null Het
Klhl20 A T 1: 161,109,532 M91K possibly damaging Het
Klrb1f T C 6: 129,053,188 F64L probably benign Het
Ldlrad3 C T 2: 102,057,948 C106Y probably damaging Het
Lilra6 T C 7: 3,912,531 T161A probably benign Het
Lrriq1 A T 10: 103,161,752 M1334K possibly damaging Het
Mepe C G 5: 104,325,402 P3R probably damaging Het
Mgat4e A G 1: 134,541,118 V396A probably benign Het
Nfx1 T G 4: 40,996,877 S651A probably damaging Het
Olfr1214 T C 2: 88,987,439 I254M possibly damaging Het
Olfr1337 A T 4: 118,782,286 C100S probably damaging Het
Olfr1361 T C 13: 21,659,182 N47S probably damaging Het
Rag2 T C 2: 101,629,677 S111P probably damaging Het
Ralgps1 A G 2: 33,143,103 V498A possibly damaging Het
Rasal2 G A 1: 157,192,804 S205L probably damaging Het
Rec8 T C 14: 55,625,330 L582P probably damaging Het
Retn G A 8: 3,657,358 R106H probably damaging Het
Rnf112 A G 11: 61,452,662 L116P probably damaging Het
Rnf213 T C 11: 119,481,240 Y4885H probably damaging Het
Sacm1l A G 9: 123,582,344 I399M probably benign Het
Sez6 G T 11: 77,975,260 G738V probably damaging Het
Spata17 A G 1: 187,140,446 V56A probably benign Het
Spata31d1a A T 13: 59,701,728 V862D probably damaging Het
Sptb A G 12: 76,624,994 probably null Het
Srpk2 C A 5: 23,545,529 G59W probably damaging Het
Ttc30a1 T C 2: 75,979,744 *665W probably null Het
Tyro3 T C 2: 119,802,298 S96P probably damaging Het
Ube2v1 A G 2: 167,610,360 S108P probably damaging Het
Usp2 C T 9: 44,075,828 S141L probably benign Het
Vamp5 T C 6: 72,370,198 D46G possibly damaging Het
Vmn1r23 T A 6: 57,926,325 Q156L probably benign Het
Vmn2r6 C T 3: 64,547,408 S490N probably benign Het
Vps39 A T 2: 120,352,959 I10N probably damaging Het
Vwf C T 6: 125,645,934 Q1755* probably null Het
Wdfy4 A T 14: 33,155,760 H82Q probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Wdr72 A G 9: 74,210,561 T852A probably benign Het
Zfp1 T A 8: 111,669,723 C92* probably null Het
Zfp426 A T 9: 20,475,073 probably benign Het
Zfp442 C T 2: 150,411,210 probably null Het
Zfp74 T C 7: 29,936,045 probably benign Het
Other mutations in Rai1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Rai1 APN 11 60185391 missense probably damaging 1.00
IGL00952:Rai1 APN 11 60187992 nonsense probably null
IGL01118:Rai1 APN 11 60187438 missense probably damaging 0.98
IGL02540:Rai1 APN 11 60186924 missense probably benign 0.09
IGL02624:Rai1 APN 11 60188743 missense probably damaging 1.00
IGL02696:Rai1 APN 11 60193956 missense probably benign
IGL02940:Rai1 APN 11 60187018 missense probably benign 0.03
IGL02970:Rai1 APN 11 60185733 missense probably damaging 1.00
IGL03006:Rai1 APN 11 60188205 missense possibly damaging 0.95
R0557:Rai1 UTSW 11 60190495 missense probably benign 0.00
R1438:Rai1 UTSW 11 60185395 missense probably benign 0.00
R1712:Rai1 UTSW 11 60187602 missense probably benign
R1837:Rai1 UTSW 11 60189398 missense probably damaging 1.00
R1899:Rai1 UTSW 11 60185920 missense probably benign 0.16
R2024:Rai1 UTSW 11 60185589 missense probably damaging 0.99
R2141:Rai1 UTSW 11 60189467 missense possibly damaging 0.94
R2168:Rai1 UTSW 11 60187596 missense probably benign 0.01
R2404:Rai1 UTSW 11 60189924 missense probably benign
R4869:Rai1 UTSW 11 60186762 missense probably damaging 1.00
R5082:Rai1 UTSW 11 60185919 missense possibly damaging 0.48
R5093:Rai1 UTSW 11 60188656 missense probably benign 0.00
R5221:Rai1 UTSW 11 60190597 missense probably damaging 1.00
R5503:Rai1 UTSW 11 60186453 missense probably benign 0.00
R5587:Rai1 UTSW 11 60189859 missense probably damaging 1.00
R5849:Rai1 UTSW 11 60190521 missense possibly damaging 0.90
R5914:Rai1 UTSW 11 60187804 missense probably benign
R5950:Rai1 UTSW 11 60187593 missense probably damaging 1.00
R6111:Rai1 UTSW 11 60187906 missense probably damaging 0.99
R6450:Rai1 UTSW 11 60186603 missense probably benign 0.30
R6785:Rai1 UTSW 11 60188794 missense probably benign
R6889:Rai1 UTSW 11 60185715 missense probably damaging 1.00
R7296:Rai1 UTSW 11 60188673 missense probably benign 0.39
R7388:Rai1 UTSW 11 60189375 missense possibly damaging 0.46
X0018:Rai1 UTSW 11 60186436 missense probably benign 0.03
X0019:Rai1 UTSW 11 60189940 missense probably benign 0.14
X0024:Rai1 UTSW 11 60187395 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AAGAACCTCGTGTCCAGGAC -3'
(R):5'- ACAATGGCTTCCTGCAGTC -3'

Sequencing Primer
(F):5'- AGCACTGTAGCCCTGAAGG -3'
(R):5'- TGCAGTCCCAGGATCTCG -3'
Posted On2016-03-17