Mutagenetix > Incidental Mutation

Incidental Mutation 'R4894:Sez6'

377508

Institutional Source

Beutler Lab

Gene Symbol

Sez6

Ensembl Gene

ENSMUSG00000000632

Gene Name

seizure related gene 6

Synonyms

D11Bhm177e, sez-6

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4894 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77930800-77979048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 77975260 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Valine at position 738 (G738V)

Ref Sequence

ENSEMBL: ENSMUSP00000091532 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000646] [ENSMUST00000093995]

AlphaFold

Q7TSK2

Predicted Effect

probably damaging
Transcript: ENSMUST00000000646
AA Change: G738V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000000646
Gene: ENSMUSG00000000632
AA Change: G738V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	223	235	N/A	INTRINSIC
CUB	241	350	9.36e-2	SMART
CCP	354	409	1.23e-10	SMART
CUB	413	524	1.41e-28	SMART
CCP	529	586	5.43e-12	SMART
CUB	590	701	7.49e-24	SMART
CCP	707	762	3.09e-16	SMART
CCP	768	827	3.5e-15	SMART
CCP	835	892	1.42e-15	SMART
transmembrane domain	910	932	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000093995
AA Change: G738V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000091532
Gene: ENSMUSG00000000632
AA Change: G738V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	223	235	N/A	INTRINSIC
CUB	241	350	9.36e-2	SMART
CCP	354	409	1.23e-10	SMART
CUB	413	524	1.41e-28	SMART
CCP	529	586	5.43e-12	SMART
CUB	590	701	7.49e-24	SMART
CCP	707	762	3.09e-16	SMART
CCP	768	827	3.5e-15	SMART
CCP	835	892	1.42e-15	SMART
transmembrane domain	923	945	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126866

Predicted Effect

probably benign
Transcript: ENSMUST00000140630

SMART Domains

Protein: ENSMUSP00000115660
Gene: ENSMUSG00000000632

Domain	Start	End	E-Value	Type
CUB	29	140	9.8e-28	SMART
CCP	157	214	5.43e-12	SMART
Pfam:CUB	218	278	1.6e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142542

Predicted Effect

probably benign
Transcript: ENSMUST00000151982

SMART Domains

Protein: ENSMUSP00000132041
Gene: ENSMUSG00000000632

Domain	Start	End	E-Value	Type
low complexity region	57	69	N/A	INTRINSIC
CUB	75	184	9.36e-2	SMART
CCP	188	243	1.23e-10	SMART
CUB	247	358	8.08e-29	SMART
low complexity region	379	394	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155087

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain five cysteine-rich motifs that are similar to sushi domains, as well as two domains similar to the amino terminal half of the CUB (for complement C1r/C1s, Uegf, Bmp1) domain. Mutations in this gene have been associated with febrile seizures. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased short dendrites, decreased excitatory synaptic signaling, resistance to pharmacologically induces seizures, decreased activity and impaired learning and coordination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf1	C	A	17: 43,299,084	Y176*	probably null	Het
Akap13	T	A	7: 75,725,320	M1900K	possibly damaging	Het
Ankrd36	A	G	11: 5,635,332	E381G	probably damaging	Het
Ap3s1	T	C	18: 46,758,116		probably null	Het
Cacna1e	G	T	1: 154,488,805	S341*	probably null	Het
Camk1d	G	A	2: 5,354,728	S161L	probably damaging	Het
Cdh23	G	T	10: 60,337,851	H1619Q	probably benign	Het
Chd7	T	A	4: 8,838,629	I1276N	probably damaging	Het
Clca1	A	G	3: 145,013,901	V436A	probably damaging	Het
Ctcfl	G	A	2: 173,117,403	P177S	probably benign	Het
Dab2ip	A	G	2: 35,730,527		probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Epc1	A	T	18: 6,449,011	S495R	probably benign	Het
Espl1	A	G	15: 102,322,323		probably null	Het
Eya4	T	C	10: 23,109,854	E583G	possibly damaging	Het
Fam111a	C	G	19: 12,588,549	T554R	probably benign	Het
Fbxo18	A	T	2: 11,762,960	I359N	probably damaging	Het
Fer1l6	T	C	15: 58,618,902	C1023R	probably damaging	Het
Gm14139	T	A	2: 150,191,979	C104*	probably null	Het
Helz2	G	C	2: 181,236,147	P953A	probably benign	Het
Ifi204	G	T	1: 173,760,242	S117Y	probably damaging	Het
Igfn1	G	A	1: 135,954,782	T2775M	probably damaging	Het
Igsf9	A	G	1: 172,498,067	T1101A	probably benign	Het
Ipo13	A	C	4: 117,903,441	I614S	probably damaging	Het
Ipo13	A	G	4: 117,904,490	I476T	possibly damaging	Het
Kdm2b	C	A	5: 122,940,967	E308*	probably null	Het
Klhl20	A	T	1: 161,109,532	M91K	possibly damaging	Het
Klrb1f	T	C	6: 129,053,188	F64L	probably benign	Het
Ldlrad3	C	T	2: 102,057,948	C106Y	probably damaging	Het
Lilra6	T	C	7: 3,912,531	T161A	probably benign	Het
Lrriq1	A	T	10: 103,161,752	M1334K	possibly damaging	Het
Mepe	C	G	5: 104,325,402	P3R	probably damaging	Het
Mgat4e	A	G	1: 134,541,118	V396A	probably benign	Het
Nfx1	T	G	4: 40,996,877	S651A	probably damaging	Het
Olfr1214	T	C	2: 88,987,439	I254M	possibly damaging	Het
Olfr1337	A	T	4: 118,782,286	C100S	probably damaging	Het
Olfr1361	T	C	13: 21,659,182	N47S	probably damaging	Het
Rag2	T	C	2: 101,629,677	S111P	probably damaging	Het
Rai1	T	A	11: 60,186,746	D545E	probably damaging	Het
Ralgps1	A	G	2: 33,143,103	V498A	possibly damaging	Het
Rasal2	G	A	1: 157,192,804	S205L	probably damaging	Het
Rec8	T	C	14: 55,625,330	L582P	probably damaging	Het
Retn	G	A	8: 3,657,358	R106H	probably damaging	Het
Rnf112	A	G	11: 61,452,662	L116P	probably damaging	Het
Rnf213	T	C	11: 119,481,240	Y4885H	probably damaging	Het
Sacm1l	A	G	9: 123,582,344	I399M	probably benign	Het
Spata17	A	G	1: 187,140,446	V56A	probably benign	Het
Spata31d1a	A	T	13: 59,701,728	V862D	probably damaging	Het
Sptb	A	G	12: 76,624,994		probably null	Het
Srpk2	C	A	5: 23,545,529	G59W	probably damaging	Het
Ttc30a1	T	C	2: 75,979,744	*665W	probably null	Het
Tyro3	T	C	2: 119,802,298	S96P	probably damaging	Het
Ube2v1	A	G	2: 167,610,360	S108P	probably damaging	Het
Usp2	C	T	9: 44,075,828	S141L	probably benign	Het
Vamp5	T	C	6: 72,370,198	D46G	possibly damaging	Het
Vmn1r23	T	A	6: 57,926,325	Q156L	probably benign	Het
Vmn2r6	C	T	3: 64,547,408	S490N	probably benign	Het
Vps39	A	T	2: 120,352,959	I10N	probably damaging	Het
Vwf	C	T	6: 125,645,934	Q1755*	probably null	Het
Wdfy4	A	T	14: 33,155,760	H82Q	probably benign	Het
Wdr24	T	C	17: 25,826,127	Y279H	probably damaging	Het
Wdr72	A	G	9: 74,210,561	T852A	probably benign	Het
Zfp1	T	A	8: 111,669,723	C92*	probably null	Het
Zfp426	A	T	9: 20,475,073		probably benign	Het
Zfp442	C	T	2: 150,411,210		probably null	Het
Zfp74	T	C	7: 29,936,045		probably benign	Het

Other mutations in Sez6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01125:Sez6	APN	11	77977289	splice site	probably benign
IGL01142:Sez6	APN	11	77973816	missense	probably damaging	1.00
IGL02252:Sez6	APN	11	77974513	missense	probably damaging	1.00
IGL02332:Sez6	APN	11	77954742	splice site	probably benign
IGL02366:Sez6	APN	11	77976882	missense	probably damaging	0.98
IGL02479:Sez6	APN	11	77978026	missense	possibly damaging	0.84
IGL02963:Sez6	APN	11	77962949	missense	possibly damaging	0.93
velum	UTSW	11	77974549	missense	probably damaging	1.00
R0054:Sez6	UTSW	11	77953873	missense	possibly damaging	0.94
R0054:Sez6	UTSW	11	77953873	missense	possibly damaging	0.94
R0089:Sez6	UTSW	11	77974344	splice site	probably benign
R0485:Sez6	UTSW	11	77953813	missense	probably damaging	1.00
R0598:Sez6	UTSW	11	77977821	missense	possibly damaging	0.88
R0729:Sez6	UTSW	11	77976585	missense	probably benign	0.01
R1117:Sez6	UTSW	11	77974514	missense	probably damaging	1.00
R1199:Sez6	UTSW	11	77953885	missense	probably benign
R1534:Sez6	UTSW	11	77963045	missense	probably damaging	1.00
R1835:Sez6	UTSW	11	77953503	missense	probably benign
R1840:Sez6	UTSW	11	77953717	missense	possibly damaging	0.79
R1929:Sez6	UTSW	11	77972932	missense	probably damaging	1.00
R1970:Sez6	UTSW	11	77954068	critical splice donor site	probably null
R3156:Sez6	UTSW	11	77953779	missense	possibly damaging	0.63
R3930:Sez6	UTSW	11	77976882	missense	probably damaging	0.98
R3931:Sez6	UTSW	11	77976882	missense	probably damaging	0.98
R4904:Sez6	UTSW	11	77975254	missense	probably damaging	1.00
R5026:Sez6	UTSW	11	77968989	missense	probably damaging	1.00
R5040:Sez6	UTSW	11	77969089	critical splice donor site	probably null
R5057:Sez6	UTSW	11	77973153	missense	probably damaging	1.00
R5093:Sez6	UTSW	11	77976562	missense	possibly damaging	0.88
R5640:Sez6	UTSW	11	77973759	intron	probably benign
R6013:Sez6	UTSW	11	77973797	missense	probably damaging	1.00
R6126:Sez6	UTSW	11	77973804	missense	probably damaging	1.00
R6153:Sez6	UTSW	11	77977822	missense	probably damaging	0.99
R6279:Sez6	UTSW	11	77976541	missense	possibly damaging	0.63
R6300:Sez6	UTSW	11	77976541	missense	possibly damaging	0.63
R6475:Sez6	UTSW	11	77973844
R6722:Sez6	UTSW	11	77953702	missense	probably damaging	1.00
R6897:Sez6	UTSW	11	77953559	missense	probably damaging	1.00
R6910:Sez6	UTSW	11	77953869	missense	possibly damaging	0.85
R7012:Sez6	UTSW	11	77977795	missense	probably benign	0.04
R7233:Sez6	UTSW	11	77973137	missense	probably damaging	1.00
R7265:Sez6	UTSW	11	77962865	missense	probably damaging	0.96
R7289:Sez6	UTSW	11	77974323	missense	possibly damaging	0.96
R7405:Sez6	UTSW	11	77962891	missense	probably benign	0.10
R7408:Sez6	UTSW	11	77953530	missense	probably damaging	1.00
R7485:Sez6	UTSW	11	77973885	missense	probably benign	0.01
R7592:Sez6	UTSW	11	77978050	missense	probably damaging	0.99
R7778:Sez6	UTSW	11	77974549	missense	probably damaging	1.00
R7793:Sez6	UTSW	11	77977600	missense	probably damaging	1.00
R7818:Sez6	UTSW	11	77976902	missense	probably damaging	1.00
R7824:Sez6	UTSW	11	77974549	missense	probably damaging	1.00
R7980:Sez6	UTSW	11	77953842	missense	probably benign	0.34
R8008:Sez6	UTSW	11	77973256	nonsense	probably null
R8840:Sez6	UTSW	11	77976487	missense	probably damaging	1.00
R8947:Sez6	UTSW	11	77953527	missense	probably damaging	1.00
R8973:Sez6	UTSW	11	77974571	missense	probably damaging	1.00
R9040:Sez6	UTSW	11	77973936	missense	probably benign
R9081:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9082:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9092:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9094:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9095:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9097:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9169:Sez6	UTSW	11	77977647	missense	probably damaging	0.96
R9513:Sez6	UTSW	11	77974583	missense	probably damaging	1.00
X0013:Sez6	UTSW	11	77954780	missense	probably benign	0.01
X0067:Sez6	UTSW	11	77974438	critical splice acceptor site	probably null
Z1088:Sez6	UTSW	11	77973197	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CACTTTGATGCTGGCTGAGG -3'
(R):5'- GGAAGTCTTGTGACAATGGAGC -3'

Sequencing Primer
(F):5'- TGGCTGAGGAGGGGCTC -3'
(R):5'- TTGTGACAATGGAGCATCCC -3'

Posted On

2016-03-17